... cultural activities – parents get a tax credit for money they spend of these things Parents fear that if their children are unhealthy the CAS will step in Parents fear that cuts to this funding ... because they will not be able to afford the cost of testing and therefore they won t be able to provide information about the identity of the father Birth Verification: Not having a birth certificate ... participants felt that social assistance benefits should be seen as an investment towards the stability and health of our community, not simply as a cost to the community It was agreed that cuts...
Ngày tải lên: 24/03/2014, 00:20
... This house is made of bricks The keyboard I use on my computer is made of plastic Còn trường hợp các ví dụ ở nhóm sau, - trees - ví dụ The paper is made from trees thì đó cối - trees ... sang thành mô t châ t khác, mà trường hợp này là t ̀ nho thành rượu vang T ơng t ̣ bô t - flour - và trứng - eggs - với đường - sugar - đã làm thành bánh ngo t ví dụ This cake ... cake is made from all natural ingredients Tóm lại quy t ́c chung là: Nếu mô t châ t liệu nào đó vẫn giữ nguyên dạng thức của nó thì chúng ta dùng made of Nhưng nếu dạng thức...
Ngày tải lên: 14/10/2013, 16:11
Tài liệu Fittings, Flanged pipes and Valves made of Ductile Cast Iron docx
... Restrained socket joints made of ductile cast iron TYTON ®-socket joint with Tyton SIT ® TYTON ®-socket joint with TYTON SIT PLUS ® ( TSP ®) Novo-socket joint with Novo SIT ® 35 Restrained ... instruction for thrust-resisting joint Tyton SIT®, page 232 – 235 Weight in kg ≈ Tyton SIT®gasket 0,17 0,19 0,23 0,27 0,45 0,60 0,92 1,58 TYTON®-socket joints TYTON SIT PLUS® with Novo-socket ... fittings will be delivered as follows: with TYTON®-socket with TYTON®-socket and pre-chamber for thrust resisting joint Novo SIT® with screw-gland socket joint with bolted-gland socket joint...
Ngày tải lên: 27/02/2014, 02:20
Báo cáo khoa học: Hierarchical subfunctionalization of fabp1a, fabp1b and fabp10 tissue-specific expression may account for retention of these duplicated genes in the zebrafish (Danio rerio) genome docx
... 4C) Putative TATA boxes were identified using matinspector [38] and visual inspection at position 24 to 30 bp 5¢ upstream of the first transcription start site that is nearest to the initiation ... at 22 to 29 bp upstream of the second transcription start site that is located further from the initiation codon in fabp1b (Fig 4B) A TATA box is present at position 25 to 31 bp 5¢ upstream of ... FABP1 is thought to be involved in the uptake of fatty acids [5], the modulation of enzyme activity by altering lipid levels [9], the sequestering of fatty acids to protect cells against the harmful...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Biochemical characterization of rice trehalose-6-phosphate phosphatases supports distinctive functions of these plant enzymes potx
... Reverse TCAGTCATGCCCGGTGGC ACACTGAGTGCTTCTTCC ATGGATTTGAAGACAAGCAAC TTAAGTGGATTCCTCCTTCCA ATGACGAACCACGCCGGC CTACTTGCCAATCAGCCCTTT CTGTTCGTCTCGACGAGT TCTTACGGCCTCTACACC CACGCACCTACACCAAGA TGATGGGCCTCTCAGCAT ... TGATGGGCCTCTCAGCAT TCAACGGATGGGTGGAGT ACTTGGACACGAGGATGC CACGACGCTGTTCCCGTA TCAACCGTGTCCTGGACA AGTACGACGCGTGGACGA GTGTGCTGCGAAGTCATG TGCTCTCTCGCTCTCGTT AGTGTCACTGTGGTCAGG OsTPP2 (AB277360) OsTPP3 (AP004341) ... activity after heat treatment at 60 °C for [31] In contrast, the results of this study indicate that OsTPP1 and OsTPP2 are completely inactivated after incubation at 50 °C for or min, so these...
Ngày tải lên: 16/03/2014, 11:20
Memories Are Made Of This: Introduction to Memorized Deck Magictricks
... course, that if a packet of cards is cut off the top of the deck and you know the card that’s been cut to, you’ll automatically also know the precise number of cards that are contained in the cut off ... card of this cut off packet Pulse Reading Here’s a simple but quite fooling effect Have a spectator cut off a packet from the top of the tabled deck, look at the card she’s cut to (the one at the ... comprise the packet The total count tells you the original cut-to card It’s important that you realize that this simple principle, a secret counting, has much broader applications than just to the...
Ngày tải lên: 19/03/2014, 13:05
Cách dùng "Made of" và "Made from" pot
... nguyên t c dùng made of made from đơn giản Chúng ta xem ví dụ sau với made of: This shirt is made of cotton This house is made of bricks The keyboard I use on my computer is made of plastic Và ... máy t nh nhựa plastic Vì nói This shirt is made of cotton This house is made of bricks The keyboard I use on my computer is made of plastic Còn trường hợp ví dụ nhóm sau, - trees - ví dụ The ... paper is made from trees cối - trees - không nữa, mà trở thành giấy Nếu nói Wine is made from grapes - trái nho - nho không nho làm thành rượu vang, t c chuyển t thứ sang thành ch t khác, mà trường...
Ngày tải lên: 19/03/2014, 19:20
Báo cáo khoa học: Elements of the C-terminal t peptide of acetylcholinesterase that determine amphiphilicity, homomeric and heteromeric associations, secretion and degradation docx
... effect, indicates that the orientation of the aromatic cluster relative to the catalytic domain is not crucial This is consistent with the notion of a flexible junction between the catalytic domain ... not be detected (not shown) This suggests that QN did interact with the mutant AChET subunits, but induced their degradation rather than the assembly of a stable, secretable hetero-oligomer The ... well as the total areas under the sedimentation profiles, are proportional to the relative activities of the mutants, so that the surface of each peak represents the actual activity of the corresponding...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx
... subunits at various positions at the junction of the catalytic domain and the t peptide ()5 to 6), in the middle of the t peptide (19 or 21), and in the C-terminal part of the t peptide (34 to 36); ... efficiently formed dimers and tetramers, indicating residues, does not interact with detergents This indicates that this C-terminal region is flexible and that the geometry that at least part of the ... (QN-CC) This excludes the hypothesis that the two ends of the t peptide would be in close contact, so that the t peptide appears to adopt an elongated structure in the complex, as also shown without...
Ngày tải lên: 30/03/2014, 13:20
mendonc,a j.t. theory of photon acceleration
... adapt it to the optical domain This provides another proof of the interest and generality of the concept of photon acceleration We will attempt in this work to bridge the gap between the two ... useful in, at least, two different ways First, it stresses the fact that the apparently distinct phenomena of refraction and photon acceleration are nothing but two different aspects of a more ... that this phase is nothing but the photon action ψ= k · dr − ω(r , k, t) dt (2.65) In order to establish the photon trajectories we can apply the principle of minimum action, and state that the...
Ngày tải lên: 24/04/2014, 17:21
Báo cáo hóa học: " Research Article On T -Stability of Picard Iteration in Cone Metric Spaces" potx
... property ii So the self maps 1 T1 , T2 of X defined by T1 f x x 1/4 f t dt and T2 f x x 1/2 f t dt have unique fixed points but Picard’s iteration is T -stable for T1 but not T -stable for T2 References ... that Picard’s iteration is T -stable Recently Qing and Rhoades established a result for the T -stability of Picard’s iteration in metric spaces Here we are going to generalize their result to ... value of f T, x0 Then to approximate y2 , the value f T, y1 is computed to yield y2 , an approximation of f T, y1 This computation is continued to obtain {yn } an approximate sequence of {xn...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: "Research Article T -Stability of Picard Iteration in Metric Spaces" pot
... point q Also, T satisfies It remains to show that is satisfied Define pn to be the diameter of the orbit of yn ; that is, pn δ O yn , T yn , First, we show that pn is bounded: d T yn , q ≤ h ... Fixed Point Theory and Applications for each x ∈ X, q ∈ F T , and, in addition, lim d yn , T yn 0, then Picard’s iteration is T -stable Proof First, we show that the fixed point q of T is unique ... point p Then, T is Picard T -stable Proof Since T satisfies 14 for all x, y ∈ X, then T satisfies inequality of our paper Let {yn } ⊂ X and define n d yn , yn From the proof of Theorem of , lim...
Ngày tải lên: 21/06/2014, 22:20
Báo cáo hóa học: " Research Article T -Stability of Picard Iteration in Metric Spaces" potx
... point q Also, T satisfies It remains to show that is satisfied Define pn to be the diameter of the orbit of yn ; that is, pn δ O yn , T yn , First, we show that pn is bounded: d T yn , q ≤ h ... Fixed Point Theory and Applications for each x ∈ X, q ∈ F T , and, in addition, lim d yn , T yn 0, then Picard’s iteration is T -stable Proof First, we show that the fixed point q of T is unique ... point p Then, T is Picard T -stable Proof Since T satisfies 14 for all x, y ∈ X, then T satisfies inequality of our paper Let {yn } ⊂ X and define n d yn , yn From the proof of Theorem of , lim...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo hóa học: " Research Article The Equivalence between T-Stabilities of The Krasnoselskij and The Mann Iterations" pptx
... (2.11) So the Mann iteration is not T- stable Actually, by use of Theorem 2.1, one can easily obtain the non -T- stability of the other iteration, provided that the previous one is not stable The following ... Tqn = 0, limn→∞ − Tvn = 0, limn→∞ un − Tun = If the Mann or Krasnoselskij iteration is not T- stable, then the Picard-Banach iteration is not T- stable, and conversely Example 3.5 To see that the ... and T : X → X a map, {αn }⊂ (0,1) and limn→∞ − Tvn = 0, limn→∞ un − Tun = If the Mann iteration is not T- stable, then the Krasnoselskij iteration is not T- stable, and conversely Note that one...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo hóa học: " Research Article The Equivalence between T-Stabilities of The Krasnoselskij and The Mann Iterations" doc
... (2.11) So the Mann iteration is not T- stable Actually, by use of Theorem 2.1, one can easily obtain the non -T- stability of the other iteration, provided that the previous one is not stable The following ... Tqn = 0, limn→∞ − Tvn = 0, limn→∞ un − Tun = If the Mann or Krasnoselskij iteration is not T- stable, then the Picard-Banach iteration is not T- stable, and conversely Example 3.5 To see that the ... and T : X → X a map, {αn }⊂ (0,1) and limn→∞ − Tvn = 0, limn→∞ un − Tun = If the Mann iteration is not T- stable, then the Krasnoselskij iteration is not T- stable, and conversely Note that one...
Ngày tải lên: 22/06/2014, 19:20
All drawing stems from one or more of these forms pps
... 047.jpg 048.jpg 049.jpg 050.jpg 051.jpg 052.jpg 053.jpg 054.jpg 055.jpg 056.jpg Page: [ Prev ] [ Next ] ...
Ngày tải lên: 04/07/2014, 11:20
It''''s made of gold-Possibilities Possibility In The Past potx
... CH T LIỆU The wallet is made of leather./It’s a leather wallet The cup is made of china./It’s a china cup The spoon is made of metal./It’s a metal spoon The t- shirt is made of cotton./It’s a cotton ... cotton t- shirt The vase is made of glass./It’s a glass vase The frames are made of tortoise-shell./They’re tortoiseshell frame The spoon is made of wood./It’s a wooden spoon T i sản - Properties ... did throw the cup in the bin JOHN Maybe you did see him at the market John nói: Maybe you saw him at the market or Perhaps you saw him at the market or You might have seen him at the market NÓI...
Ngày tải lên: 12/07/2014, 03:20
Cách dùng Made of và Made from pot
... Thực nguyên t c dùng made of made from đơn giản Chúng ta xem ví dụ sau với made of: This shirt is made of cotton This house is made of bricks The keyboard I use on my computer is made of plastic ... máy t nh nhựa - plastic Vì nói This shirt is made of cotton This house is made of bricks The keyboard I use on my computer is made of plastic Còn trường hợp ví dụ nhóm sau, - trees - ví dụ The ... cotton - vải - ví dụ áo sơ mi thành áo vải - still is cotton Nó không thay đổi dạng thức hay trở thành ch t liệu khác Cũng t ơng t , the brick - viên gạch - ví dụ Ngôi nhà làm gạch, không thay...
Ngày tải lên: 12/07/2014, 04:20