applying the method in various languages a
Frequency of Routine and Flooding-stage Observations for Precise Annual Total Pollutant Loads and their Estimating Method in the Yodo River
... observation data excluding the monthly data Total pollutant loads during routine observations in the dry year of 2005 became small, whereas those obtained in a rainy year became larger The annual total ... was a rainy year (Q: 434m3/s) and 2003 was an average year (Q: 236m3/s) During the observation periods, years with more rainfall had larger mean pollutant loads than years with less rainfall The ... and analyzed inorganic ions and organic matter The water samples taken at the three points spanning the river during the five flooding-stages were analyzed individually, and the representative...
- 9
- 572
- 0
A study of difficulties in learning english listening skill for beginners in the asemlink of intrernational languages center and some suggested solutions
... information or entertain • Participating in a face-to-face conversation, discussing work as a partner • Watching a film, a play or a TV program to entertain • Participating in a meeting, seminar ... for learners to get information about the fact of teaching and learning listening skill in the Asemlink center After collecting information, all the data will be analyzed and drawn into the conclusion ... skill in Asemlink center in particular and in Vietnam in general Finally, the author will analyze the results of the survey, interviews as well as the teacher’s observation in teaching in order...
- 96
- 10,573
- 53
Tài liệu Community Approaches to Child Health in Malawi: Applying the Community Integrated Management of Childhood Illness (C-IMCI) Framework docx
... simultaneously discuss the same health message, they become a critical mass for changing and sustaining health beliefs and practices in the entire project area Care Groups in Malawi In Malawi, ... pneumonia and malaria They can decrease the sale of purgatives, antibiotics, and anti-diarrheal drugs and promote oral rehydration therapy, use of increased food and fluids, and when available, zinc ... generation activities and have linked individuals within the project area with local 18 Community Approaches to Child Health in Malawi Pastoral Care Groups in Rwanda Working in Rwanda’s former Kibogora...
- 33
- 555
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... et al naya OA, Kolpakov FA et al (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26, 362–367 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal ... northern blot analysis Each lane contains 15 lg of total RNA The bottom panel shows the expression of b-actin mRNA as an internal control (B) Western blot analysis The indicated cells were harvested...
- 12
- 621
- 0
Tài liệu Báo cáo khoa học: "The Structure of User-Adviser Dialogues: Is there Method in their Madness?" pdf
... requests information from the adviser so that the user can satisfy a goal In this study, these subdialogues arise from the constraints on the type of meta-plans available, ASK-ADVISER-HELP There are ... and Weinstein (1983) have made similar claims about the role of non-pronominal definite noun phrases and pronominal definite noun phrases Determine In any case, the task structure can only partially ... noun phrases will tend to occur more frequently at the beginning of subdialogues than later in the subdialogues On the other hand, pronominal noun phrases play a role in indicating and realizing...
- 7
- 399
- 0
Báo cáo khoa học: "The use of formal language models in the typology of the morphology of Amerindian languages" potx
... -aGan -aGanataGan -aGanataGanaGan -aGanaGanataGan he eats he eats(something) he feeds he feeds (a person) he command to feed If we want to model this morphological process using finite automata ... successful In the ambit that we are studying we can think that if a word is a string of prefixes, a stem and suffixes, one automata head will read will the prefixes and the other the suffixes Taking into account ... can have some value in language classification and the modeling of the great diversity of South American languages morphology can allow to obtain a formal concept of natural description of a language...
- 6
- 439
- 0
Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx
... from the human trypsinogen prepro sequence was amplified from human pancreatic cDNA using the primer set (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and inserted ... prosemin in ovarian cancers Paraffin-embedded sections were stained with antibody directed against recombinant prosemin (A) Mucinous adenocarcinoma (B) and (C) Serous adenocarcinomas, borderline ... activation by enterokinase, recombinant prosemin was incubated with Boc-Gln-Ala-Arg-MCA at 37 °C for the indicated times White and shadowed bars indicate before and after activation by enterokinase,...
- 13
- 483
- 0
Possible Strategies for Listening Comprehension: Applying the Concepts of Conversational Implicature and Adjacency Pairs to Understand Speaker Intention in the TOEFL Listening Section doc
... enjoyable tasks) ▪Maintaining and protecting motivation (making learning and tasks stimulating; setting learner specific goals; increasing their self-confidence; allowing learners to maintain a ... done are creating the basic motivational conditions, generating initial motivation, maintaining motivation, and encouraging positive retrospective self-evaluation Above all, what was particularly ... of strategy training were examined through the data of class-discussion and the evaluation of a questionnaire In addition, the fact that there have been few studies investigating the efficacy of...
- 30
- 1,048
- 0
the mit press design concepts in programming languages aug 2008
... language features in the context of several minilanguages Each of these is a simple programming language that captures the essential features of a class of existing programming languages In many cases, ... formal tools are a panacea or that formal approaches are superior to informal ones in an absolute sense In fact, informal explanations of language features are usually the simplest way to learn about ... cases, the mini -languages are so pared down that they are hardly suitable for serious programming activities Nevertheless, these languages embody all of the key ideas in programming languages Their...
- 1,347
- 250
- 0
báo cáo hóa học: " Application of a hybrid wavelet feature selection method in the design of a self-paced brain interface system" pptx
... of data collected over an interval containing the movement onset (measured as the finger switch activation) if no artifact was detected in that particular interval The interval starts at tstart ... kernel-based learning, all of the beneficial properties of linear classification methods, such as simplicity, are maintained, however, the overall classification is nonlinear in the input space, since ... discard the least informative features based on the amount of information that each feature carries regarding the output classes presence of feature i and a value of "0" indicated its absence in...
- 13
- 530
- 0
Báo cáo hóa học: " Applying the scientific method when assessing the influence of migratory birds on the dispersal of H5N1 Paul L Flint" doc
... by all available data By following the scientific principles, collecting data required for critical tests of hypotheses, and avoiding speculation, definitive conclusions regarding the dispersal ... reached more effectively Abbreviations HPAI: highly pathogenic avian influenza Competing interests The author(s) declare that they have no competing interests Acknowledgements The author thanks ... H5N1 influenza virus in Asia: implications for pandemic control Proc Nat Acad Sci 2006, 103:2845-50 Kilpatrick AM, Chmura AA, Gibbons DW, Fleischer RC, Marra PP, Daszak P: Predicting the global...
- 3
- 245
- 0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx
... Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, G: Hyers-Ulam-Rassias stability of the Appollonius quadratic mapping in RNspaces J Nonlinear Sci Appl 4, 110–119 ... equation J Inequal Appl 2011 (2011) Article ID 194394 13 Kenary, HA: On the Hyers-Ulam-Rassias stability of a functional equation in non-Archimedean and random normed spaces Acta Universitatis Apulensis ... cubic mappings and quartic mappings in random normed spaces” J Inequal Appl 2009 (2009) Article ID 214530 12 Saadati, R, Zohdi, MM, Vaezpour, SM: Nonlinear L-random stability of an ACQ functional...
- 14
- 479
- 0
Báo cáo khoa học nông nghiệp " Technical and economic feasibility of applying the Better Management Practices (BMP) to household aquaculture in Vietnam " MS4 docx
... BMP to their conditions and to maintain a farm diary that records all inputs into the trials and relevant indicators as the trial progresses Through a participatory process, relevant stakeholders ... farmers in adopting BMP on their farms Data will be processed and analysed by staff at RIA1 and UWA to serve as the basis for demonstration farm selection and kept as baseline indicators for comparison ... demonstrations will be analysed by statistical methods to assess and validate impacts of BMP practices and as a basis to draft a BMP manual In the second year the BMP manual will be verified for all...
- 9
- 364
- 0
Technical and economic feasibility of applying the Better Management Practices (BMP) to household aquaculture in Vietnam - MS2" potx
... more than ppt Salinity adaptation needs conducting by slowly adding pond water into PL bags or putting al already temperature-adapted in a big container and adding gradually pond water accordingly ... after feeding and re-operate oxygenation materials like trash, crustacean as they can be water-polluted cause and disease infection Bottom algae and floating lab-lab need manually removing using Keep ... can be eliminated and skimmed using clean cloths or inner part of maize 7) Temperature stratification (mainly caused by heavy rain): draining out top layer water, operating mixing devices, and...
- 11
- 400
- 0
Collaboration for Agriculture & Rural Development: Technical and economic feasibility of applying the Better Management Practices (BMP) to household aquaculture in Vietnam " MS6 pot
... + Investment and attention of goverment + Self- abilities in environment measurement and disease management + Seed management and controlling + Desease informing and quaraintining POND PREPARATION ... utilization Lime is used in the purpose of decontamination,disinffection and increasing pH and making pH stable (buffering L systembased on Carbonic - Bicarbonate – Carbonate balance) Liming dose ... mainly known as NaCl, gives suitable concentration for many aquaculture species at 15-25‰ 2.8 Alkalinity What constitutes alkalinity + Alkalinity measured as mg CaCO3/l indicates concentration of...
- 19
- 387
- 0
Technical and economic feasibility of applying the Better Management Practices (BMP) to household aquaculture in Vietnam - MS7 " ppt
... during visiting time of Australian team in Vietnam The methodology of data collection, data analysis and report writing have done during the Vietnamese team visiting Australia for days in the ... Improving the capacity to manage and practice project and visited the UWA, and Australian team come exchanging information and to the RIA1 to work experience on project on the project management ... farms before stocking 1) The cross visiting and exchange information between Australian and Vietnamese team are the base to improve the project management ability, information processing, data...
- 16
- 310
- 0
Collaboration for Agriculture & Rural Development: Technical and economic feasibility of applying the Better Management Practices (BMP) to household aquaculture in Vietnam - MS 8 " doc
... Max actual Min actual Average Max Min Average Max Min Average Max Min Average Max Min Average Max Min Average Max Min Average Max Min Average Max Min Average 33.00 Bold figures indicate that the ... Alkalinity is defined as the sum of exchangeable bases reacting to neutralise acid when an acid is added to water Alkalinity plays two important roles in water Bicarbonates, and carbonates to a ... SUMA/NACA project (Support to Brackish Water and Marine Aquaculture/Network of Aquaculture Centre in Asia-Pacific), and a NAFIQAVED (National Fisheries Quality Assurance and Veterinary Directorate)...
- 43
- 326
- 0
Collaboration for Agriculture & Rural Development:: " Technical and economic feasibility of applying the Better Management Practices (BMP) to household aquaculture in Vietnam - MS 9 " pot
... Centre (ADS) supported by AuSAID – Australia Australian Centre for International From 19-21/3/2003 Agricultural Research- ACIAR – Australia training program for AuSAID grantee Evaluation training ... cooperative and and Mr Dinh Van Can, head of quaassociation as project local staff Three demonstration farms: - Farm: Nguyen Van Tuan - Farm: Cao Xuan Hoa - Fam: Dinh Van Dung 3.1.1.2 Ha Tinh province ... staff and trial farms This BMP project also applies the “open” training method, it mean that trainees were “centre” of training courses In each training course, the expert provided training materials...
- 51
- 371
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25