applying multiple formatting functions to a string

... System.EventArgs e) { ds = new DataSet( ); // Create the DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME, ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Load ... schema and data for the table da.FillSchema(ds, SchemaType.Source, TABLENAME); da.Fill(ds, TABLENAME); // Columns in XML representation of data as attributes foreach(DataColumn col in ds.Tables[TABLENAME].Columns) ... and changed records in the DataSet to the stored procedure NText parameter @data and the XML representation of deleted records in the DataSet to the stored procedure NText parameter @datadelete...

Ngày tải lên: 21/01/2014, 11:20

... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm MgCl2, ... feriatus: hepatopancreas-specific expression and farnesoic acid stimulation of vitellogenin gene expression Mol Reprod Dev 70, 288–300 Tsutsui N, Saido-Sakanaka H, Yang WJ, Jayasankar V, Jasmani ... eyestalk (Es) and thoracic ganglia during the gonad maturation cycle Each lane represents an RNA sample from the eyestalk or the thoracic ganglion of one shrimp The last lane shows the RNA samples...

Ngày tải lên: 16/03/2014, 05:20

... with manageable complexity Our primary aim was to design a task which allows us to investigate the properties of our grammar-based approach and to compare its performance with that of a competitive ... corresponds to a signal length of roughly 50 minutes Rather than applying our model to the original broadcast-news transcription task, we used the above data to create an artificial recognition task with ... our approach is to use an accurate, linguistically motivated grammar, and it is undesirable to weaken the constraints encoded in the grammar Instead, we allow the parser to attach any sequence of...

Ngày tải lên: 17/03/2014, 02:20

... CTCGGCCTCAACTACAGTCGT ACAGGTAGCTGAGCAGCAGAC CAGCTAGCTGGCCGGGATAGC P1F P1R GCCGATCATATCTGCTATGG CCATAGCAGATATGATCGGC P2F P2R ATGTACAATTCAGCTCTTGCT AGCAAGAGCTGAATTGTACAT P3F P3R GCTGTTATACCAGTATATGG CCATAT ... GCTGTTATACCAGTATATGG CCATAT ACTGGTATAACAGC P4F P4R TGGTGTACTAATTTGATCTATG CATAGATCAAATAGTACACCA H1 CGAGTCGACCGGAGGACCTTT GGCCCTGCGTCGACCGA TCGGTCGACGCAGGGCCAAAG GTCCTCCGGTCGACTCG H2 Experiment CmtR ... (5¢- to 3¢) P1 GTACTATTGGATCCATGCTGACG P2 GTCCTGTAAGCTTAAGTCGTGTC P3 P4 P6 TTCCCGCATCTCACACGTCA CATATCTGCTATGGATGTAC GTCACACCTTTCGTCGCAGC P8 94RTf 94RTr 1994intR TGTTATACCAGTATATGGTGTACTA CTCGGCCTCAACTACAGTCGT...

Ngày tải lên: 23/03/2014, 04:21

... seminario funzionalità del sistema faggeta, Accademia Italiana di Scienze Forestali, 1995, pp 309–318 [6] Carey E., Sala A. , Keane R., Callaway R.M., Are old forests underestimated as global carbon sinks? ... Bascietto, G Scarascia-Mugnozza Table II Cambial age, C pool and increment of the sampled trees in the mixed broadleaf stand, as for year 2000 Arabic numbers indicate beech trees, letters mark ... wood to fresh wood Species Abies alba Mill Alnus glutinosa Gaertn Carpinus betulus L Castanea sativa Mill Cupressus sempervirens L Fagus sylvatica L Fraxinus excelsior L Juglans regia L Larix...

Ngày tải lên: 08/08/2014, 01:22

... Vif was amplified using the forward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and the reverse primer VifR, 5'GGATAAACAGCAGT TGTTGC3' The resulting amplicons ... proviral DNA, cRNA, and vRNA across each individual infection (YA, YB and YC) for Rounds and was determined Statistical significance was calculated using the t-test assuming equal variance with a ... 5'CAGGGAGATTCTAAAAG3', and the reverse primer YRHHYmutR, 5'CTTATTTTTGGATTAGTAC TTTCAGCGGCAGCTGCAGCAAACCAGTCCTTAGCTTTC C3', were used to amplify the N-terminal region of Vif The C-terminal portion of Vif was...

Ngày tải lên: 13/08/2014, 05:21

Ngày tải lên: 13/08/2014, 19:20

... environment (a1 and ms1 ): a= where and a0 = a1 a0 a1 + sire a0 a1 + dam ms0 , ms1    a0 a0 ,a1     , ms = ms0 ∼ N(0, Var(ms))    Var (a) =     ms1 a0 ,a1 a1    /2 a0 /2 a0 ,a1  ... a Standard deviations are given as a subscript Environmental parameters used in models and are calculated in the same way, leading to the same correlation between simulated herd effects and calculated ... calculated back from the polynomial scale to the original scale per replicate and then averaged across replicates ASREML [4] was used for all analyses For all situations considered, 50 replicates...

Ngày tải lên: 14/08/2014, 13:22

... parents represented only 9% and 8% of the total number of animals, for strains A and B respectively, the reduced animal model (RAM) of (auaas and Pollak (1980) was used With RAM, all the equations ... a diagonal matrix whose elements n A c if both parents are known and 3/4 if one parent if known It was assumed that there is equal parental information for all nonparents and that parents are ... matrices associated with b and indicates direct (Kronecker) product e a and ) * ( It was assumed that A is the relationship residual (co)variance matrix between animals G and R are unknown matrices...

Ngày tải lên: 14/08/2014, 20:20

... attempt to achieve the aims of the research, a quasi-experimental research was mainly used as an appropriate approach to establish the cause-effect relationship between note-taking strategies and ... brings a plausible interpretation to the message by recalling background information relevant to the particular context and subject matter  assigns a literal meaning to the utterance  assigns an ... English as Foreign Language ESL English as Second Language SD Standard Deviation SLA Second Language Acquisition TOEFL Test of English as a Foreign Language ULIS University of Language and International...

Ngày tải lên: 02/03/2015, 14:30

... speak so as to carry out many transactions and speaking skill is a medium of communication which languages are learnt through To speak a language, especially a foreign language, learners need to ... Cooperative language learning and affective factors In Arnold, J (Eds.) Affect in Language Learning Cambridge University Press 10 Crandall, J (1999) Cooperative language learning and affective factors ... going to teach and how he is going to teach what he has planned to teach in the time allotted to him 3.4.3 Recommendations for materials It is a great help to teachers if they have access to suitable...

Ngày tải lên: 28/03/2015, 08:59

... usually an ad campaign or program to catch public attention There is nothing wrong with that approach except that it is usually just that—an annual advertising campaign and not the actual story ... Plan and the Operational Plan 213 Analysis of Company Performance 214 Analysis of Competition 215 Analysis of Market and Market Share 216 Analysis of Mission 217 Analysis of Resources 218 Analysis ... performance that must be tracked against the business plan They are organizational, team, and individual All lead to the strategic goals Figure 12-4 During the sustaining phase you must pay attention...

Ngày tải lên: 21/09/2012, 17:33

... wake at a. m., but nap for two hours or so in the early afternoon Thus the influence on one's sleep pattern is worthy of consideration when choosing an occupation ...

Ngày tải lên: 04/10/2012, 10:02

Ngày tải lên: 04/10/2012, 10:24

... tuberculate, supplemental and odontome; however, the Literature also reports a classification according to intraoral position of the supernumerary teeth: Mesiodens; Paramolar; Distomolar and Parapremolar ... investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission of the algic ... without functional limitations or fever No occlusal hindrance was caused by these supernumerary teeth Although anamnesis allowed to exclude stomatological pathologies, congenital anomalies and genetic...

Ngày tải lên: 25/10/2012, 11:40

... lý bán vé tàu Phú Quốc, bán vé máy bay - Sản xuất và kinh doanh hàng nông sản và thủy sản - Mua bán xe gắn máy bánh, phương tiện vận tải • Nhà hàng, khách sạn, khu du ... đóng gói bao bì nông sản, mua bán nông sản Nhà máy chế biến nông sản xuất khẩu I: xay xát thóc lu a, a nh bóng gạo; mua bán lương thực; đóng gói lu a gạo Nhà máy chế biến ... nông sản xuất khẩu V: xay xát thóc lu a, a nh bóng gạo; mua bán lương thực; đóng gói lu a gạo Nhà máy chế biến gạo xuất khẩu Định Thành: xay xát thóc lu a, a nh bóng gạo;...

Ngày tải lên: 29/11/2012, 08:58

Ngày tải lên: 18/03/2013, 01:44

... bào chư a cu a bị cáo Nếu bị cáo vắng mặt có lí chính a ng thì phải hoãn phiên to a, lí chính a ng phải được báo cho to a án biết trước khai mạc phiên to a Nếu vụ a n ... luận và thông qua tại phòng xử a n Biên bản phiên to a Tại phiên to a, quá trình xét xử, thư kí to a án có nhiệm vụ ghi rõ mội diễn biến ở phiên to a Biên bản phiên to a là ... vi theo tội danh mà viện kiểm sát truy tố và to a án a quyết định đ a xét xử To a án có thể xét xử bị cáo theo khoản khác với khoản mà viện kiểm sát a truy tố cùng...

Ngày tải lên: 04/04/2013, 11:11