apply a tourniquet to an amputation of the limb

VCM 2012 12 Một phương pháp đánh giá về ảnh hưởng của bộ lọc đến  hình dạng tín hiệu điện tim  A method evaluates an effect of the filter to ECG signal

VCM 2012 12 Một phương pháp đánh giá về ảnh hưởng của bộ lọc đến hình dạng tín hiệu điện tim A method evaluates an effect of the filter to ECG signal

... Science and Engineering, 2011 [5] Wan-hua Lin, Mico Yee-Man Wong, Li-na Pu, Yuan-ting Zhang, “Comparison of Median Filter and Discrete Dyadic Wavelet Transform for Noise Cancellation in Electrocardiogram”, ... Discrete Wavelet Transform for Quality Diagnosis of Biomedical ECG Signal, International Journal of Computer Applications, 2011 [7] Mikhled Alfaouri and Khaled Daqrouq, ECG Signal Denoising By Wavelet ... Electrocardiogram”, 32nd Annual International Conference of the IEEE EMBS Buenos Aires, Argentina, August 31 - September 4, 2010 Mã bài: 20 82 [6] Ramesh D Mali, Dr U.L Bombale, Removal of 50Hz PLI...

Ngày tải lên: 25/07/2015, 07:27

8 465 1
Use of an extension of the park's transformation to determine control laws applied to a non sinusoidal permanent magnet synchronous motor

Use of an extension of the park's transformation to determine control laws applied to a non sinusoidal permanent magnet synchronous motor

... electromotiveforces, the motor being not supply Park's transformation AAer this first transfoxmation, the Pa& transfomation allows us to work in the rotor's reference, through a rotation of an angle PO.Using the ... PROPOSAL OF AN EXTENSION OF THE PARK'S TRANSFORMATION Classical Park's transformation is in fact the succession of two transfomations The torque is then given by: T, = p.(@~,.io+@'did+@'q.iq) For a ... are not able to follow the reference currents The angle between the rotor and the stator induction is no more 90", like for a classical sinusoidal synchronous motor the average value of the torque...

Ngày tải lên: 03/01/2014, 19:50

6 438 2
Tài liệu Exporting the Results of a Query to an Array pdf

Tài liệu Exporting the Results of a Query to an Array pdf

... from the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the ... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and ... = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection of rows in the...

Ngày tải lên: 26/01/2014, 10:20

5 310 0
a means to an end the biological basis of aging and death apr 1999

a means to an end the biological basis of aging and death apr 1999

... gland of the brain, and the pattern of synthesis and release of these hormones changes in an age-dependent manner In virtually every species, the degenerative changes associated with aging are ... cardiovascular disease or a genetic disorder—increases an organism's susceptibility to disease and accidental death T h e gradual physical weakening that accompanies aging will make an animal ... disease, heart attack, cancer, or other age-related disorders W h e n talking about the basic biology of aging, as opposed to its A M E A N S TO AN E N D outward physical and behavioral manifestations,...

Ngày tải lên: 11/06/2014, 05:26

246 670 0
báo cáo khoa học: "Hemolytic anemia due to acute cytomegalovirus infection in an immunocompetent adult: a case report and review of the literature" doc

báo cáo khoa học: "Hemolytic anemia due to acute cytomegalovirus infection in an immunocompetent adult: a case report and review of the literature" doc

... hospitalization, analyzed data from the literature, and wrote the article ST and PN analyzed data from the literature CMD was the major contributor in writing the manuscript AC and EG followed up the ... hospital discharge, the fever persisted, and the patient complained of progressive asthenia At admission to our hospital, the patient appeared pale and asthenic Physical examination revealed a body ... steroids and/or antiviral therapy One of those cases had a clinical history similar to that of our patient [5], with a hemoglobin level that reached 5.1 g/ dL, and the patient experienced a full and...

Ngày tải lên: 11/08/2014, 02:21

3 394 0
Law as a Means to an End  Threat to the Rule of Law  Law in Context

Law as a Means to an End Threat to the Rule of Law Law in Context

... we breathe This operates in various ways: as an account of the nature of law, as an attitude toward law that professors teach students, as a form of constitutional analysis, as a theoretical perspective ... overlapping and sometimes conflicting regimes of customary law: feudal law, the law of the manor, Germanic customary law, residues of Roman law, trade customs, and local customs Customary law was said to ... law, as an orientation of lawyers in their daily practice, as a strategic approach of organized groups that use litigation to further their agendas, as a view toward judges and judging, as a...

Ngày tải lên: 13/10/2016, 11:31

269 904 0
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

... behind the attacks) and many of his top aides were in vain In March 2003, the U S-led coalition attacked Iraq reasoning that Iraq was storing weapons of mass destruction and maintaining the alleged ... launched war against Afghanistan This brought victory to the U S and its coalition at the expense of well over 200 deaths to the American side but the efforts to capture Osama bin Laden (the prime ... believed to have influence on the data speech Chapter 2: Methodology and analysis procedures describes the data collection method and procedures of analyzing data Chapter 3: Data analysis and discussion...

Ngày tải lên: 18/12/2013, 10:08

44 579 0
An integration of the four english skills in teaching reading texts to beginner learners at asemlink international language centre

An integration of the four english skills in teaching reading texts to beginner learners at asemlink international language centre

... approach to language teaching The integrated approach to language teaching in general and reading comprehension teaching in particular has many advantages over the approach to teaching language skills ... (1998: 22) To support Herzan’s idea, River also points out that students can learn to operate the language and they can easily transfer the acquired language to the other areas by integrating the four ... well as grammar and discourse markers And then they can understand the whole part of the reading The readers have to go from the smallest part to the larger one Rebecca Treiman has found out that...

Ngày tải lên: 18/12/2013, 10:08

90 577 1
How to get out of the friendzone: turn your  friendship into a  relationship

How to get out of the friendzone: turn your friendship into a relationship

... look at him again Tiana doesn’t know what she’ll if Laura and James get together She longs for the day when James gets a job at another company, because maybe then she could work up the courage to ... each other, Sam ran into Katie, who threw her arms around him and whispered that they needed to talk; she’d heard he was dating someone and wanted to know all about it After hearing about Cara, ... him Then he met Cara at his coed dodgeball tournament She was pretty and nice and seemed to like him back They started dating and things were going well At a party soon after Sam and Cara started...

Ngày tải lên: 10/02/2014, 18:17

240 1,1K 1
Tài liệu Effect modification of air pollution on Urinary 8-Hydroxy-2’-Deoxyguanosine by genotypes: an application of the multiple testing procedure to identify significant SNP interactions ppt

Tài liệu Effect modification of air pollution on Urinary 8-Hydroxy-2’-Deoxyguanosine by genotypes: an application of the multiple testing procedure to identify significant SNP interactions ppt

... Vasan RS: Vitamin D deficiency and risk of cardiovascular disease Circulation 2008, 117:503-511 65 Quan F, Korneluk RG, Tropak MB, Gravel RA: Isolation and characterization of the human catalase ... Szeszenia-Dabrowska N, Zaridze D, Lissowska J, Rudnai P, Fabianova E, Mates D, Foretova L, Janout V, Bencko V, Gaborieau V, Gioia-Patricola L, Bellini1 I, Barale R, Canzian F, Hall J, Boffetta P, ... each of candidate SNP via adding an interaction term of the SNP and the pollutant simultaneously with both the main effect terms adjusting for the same covariates as the above [12,23] Because two...

Ngày tải lên: 17/02/2014, 22:20

9 773 0
Tài liệu THE VALUE OF IMPROVED PUBLIC SERVICES: AN APPLICATION OF THE CHOICE EXPERIMENT METHOD TO ESTIMATE THE VALUE OF IMPROVED WASTEWATER TREATMENT INFRASTRUCTURE IN INDIA docx

Tài liệu THE VALUE OF IMPROVED PUBLIC SERVICES: AN APPLICATION OF THE CHOICE EXPERIMENT METHOD TO ESTIMATE THE VALUE OF IMPROVED WASTEWATER TREATMENT INFRASTRUCTURE IN INDIA docx

... Investment and Tourism: Empirical Evidence from India Saroja Selvanathan, E .A Selvanathan and Brinda Viswanathan * Working Paper 47/2009 Ecology, Environment and Sustainable Development in Indian Fiscal ... Zero Quality of Quantity of Regeneration Treated Treated of the Park Wastewater Wastewater Average Average Average Average Average Average vs vs vs vs vs vs profile profile profile profile profile ... sewage deposited in the Ganga The most noteworthy of these is the Ganga Action Plan (GAP) Initiated in 1984 by the Indian Government, and supported by the Netherlands, UK and voluntary organizations,...

Ngày tải lên: 18/02/2014, 01:20

40 473 1
A Review of Approaches to Mobility Telemonitoring of the Elderly in Their Living Environment potx

A Review of Approaches to Mobility Telemonitoring of the Elderly in Their Living Environment potx

... In the absence of a clinical evaluation, a simulator was developed to simulate 70 days of data and test the ability of the system to store large amounts of data and to manipulate these data to ... BT Laboratories If an alarming situation was detected, an automated call was made to the monitored home The monitored subject could indicate that there was no problem by answering the call and ... using the GSM network it detects hardware failure The WPAN server includes an alarm button, a display to show the state of the IAU, and an optical/acoustic signal to confirm transmission to a remote...

Ngày tải lên: 05/03/2014, 21:20

17 604 1
Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt

Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt

... the alpha subunit Nucleic Acids Res 35, 2825–2832 20 Abe Y, Jo T, Matsuda Y, Matsunaga C, Katayama T & Ueda T (2007) Structure and function of DnaA N-terminal domains: specific sites and mechanisms ... and Lys41 In addition, species of the class Bacilli often have one to four Lys or Arg residues in variable positions of the N-terminal part of the a1 helix These residues also contribute to an ... Mizrahi for their useful comments and suggestions This work was supported by Howard Hughes Medical Institute and Ministry of Education and Science of Lithuania Analysis of surface features and...

Ngày tải lên: 05/03/2014, 23:20

10 420 0
An Assessment of the Environmental Implications of Oil and Gas Production: A Regional Case Study pot

An Assessment of the Environmental Implications of Oil and Gas Production: A Regional Case Study pot

... Canadian provinces of British Columbia and Manitoba forged an agreement establishing the initiative Since that time, Montana and Utah have also signed on as participants, and Alaska, Colorado, ... oxides, and lead These pollutants can cause harm to human health and the environment and can lead to property damage Of the six pollutants, particle pollution and ground-level ozone are the most ... Tribes of the Flathead Reservation in Montana and the Assiniboine and Sioux Tribes of the Fort Peck Indian Reservation in Montana have federally-approved water quality standards Where EPA has not approved...

Ngày tải lên: 06/03/2014, 16:20

115 745 0
Báo cáo Y học: Amphipathic property of free thiol group contributes to an increase in the catalytic efficiency of carboxypeptidase Y pot

Báo cáo Y học: Amphipathic property of free thiol group contributes to an increase in the catalytic efficiency of carboxypeptidase Y pot

... Bio-Rad, Hercules, CA, USA Bistris was obtained from Nacalai Tesque, Kyoto, Japan All other chemicals were of reagent grade and obtained locally Strains and plasmid DNA The plasmid pTSY3 containing ... all substrates than the other mutants This value was even higher than the wild-type when Cbz-Ala-Phe was used as a substrate The characteristics of the C341S mutant were similar to those of C341G ... transformed by the method of Hanahan [16] using a standard transformation buffer Purification of wild-type and mutant forms of carboxypeptidase Y Typical purifications were carried out as previously...

Ngày tải lên: 08/03/2014, 23:20

6 459 0
The Gospels in the Second Century An Examination of the Critical Part of a Work Entitled ''''Supernatural Religion'''' pptx

The Gospels in the Second Century An Examination of the Critical Part of a Work Entitled ''''Supernatural Religion'''' pptx

... eleusetai kai apokatastaesei panta, lego de humin, hoti Aelias aedae aelthe kai ouk epegnosan auton all' epoiaesan auto hosa aethelaesan Kai gegraptai hoti tote sunaekan oi mathaetai, hoti peri Ioannon ... taen gunaika autou kai anastaesei sperma to adelpho autou.] _Deut._ xxv [Greek: Ean de katoikosin adelphoi epi to auto, kai apothanae eis ex auton, sperma de mae ae auto, ouk estai ae gunae tou tethnaekotos ... tou Baptistou eipen autois.] _Matt._ xvii 11-13 [Greek: Aelias men erchetai apokatastaesei panta, lego de humin hoti Aelias aedae aelthen kai ouk epegnosan auton, alla epoiaesan auto hosa aethelaesan,...

Ngày tải lên: 17/03/2014, 15:20

162 496 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

... D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢) and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; forward primer ... (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse primer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D45–47; forward primer ... monoclonal antibody In vitro nuclear transport (see ÔMaterial and methodsÕ) was carried out in the presence of cytosol and an ATP-regenerating system (A J) The effects on nuclear transport of the ATP-regenerating...

Ngày tải lên: 18/03/2014, 01:20

8 1,1K 0
barriers to asset recovery an analysis of the key barriers and recommendations for action

barriers to asset recovery an analysis of the key barriers and recommendations for action

... Argentina; Azerbaijan; Bangladesh; Belize; Brazil; Cameroon; Canada; the Cayman Islands; Chile; Colombia; Costa Rica; Ecuador; France; Germany; Guatemala; Guernsey; Haiti; Hong Kong SAR, China; Indonesia; ... Chun (Singapore), Koji Hayashi (Japan), Edward Hoseah (Tanzania), Henderson Hunte (Cayman Islands), Takeshi Hiramatsu (Japan), Karen Hughes (St Kitts and Nevis), Giovanni Ilacqua (Italy),Toshifumi ... Guatemala, Haiti, Indonesia, Mexico, Morocco, Nigeria, Panama, Paraguay, Peru, the Philippines, St Kitts and Nevis, St Lucia, St Vincent and the Grenadines, Tanzania, and Trinidad and Tobago 14 Practitioners...

Ngày tải lên: 26/03/2014, 14:08

200 927 0
handbook of biochemical kinetics a guide to dynamic processes in the molecular life sciences

handbook of biochemical kinetics a guide to dynamic processes in the molecular life sciences

... Adenine Alanine or alanyl aa Amino acid aaRS Aminoacyl-tRNA ACAT Acyl-CoA:cholesterol acyltransferase ACES N-(2-Acetamido)-2aminoethanesulfonic acid ACh xvi Acetylcholine ATCase Aspartate transcarbamoylase ... studied actins are those obtained in high abundance from rabbit muscle and Acanthamoeba castellani Many features of actin polymerization are analogous to tubulin, and the reader may wish to consult ... reactant removes an atom (neutral or charged) from the other reacting entity An example is the generation of a free radical by the action of an initiator on another molecule If abstraction takes...

Ngày tải lên: 01/04/2014, 10:21

811 432 0
a tear is an intellectual thing the meanings of emotion feb 2000

a tear is an intellectual thing the meanings of emotion feb 2000

... complex and conflicting history The antithetical meaning of primal expressions may be as basic and inevitable as the antithetical meaning of primal words Antithetical meaning is in fact open to two ... of the eye) arises and so stimulates the lacrimal glands in animals other than human beings, then we may have a basis for explaining their lack of emotional tears For it is the other series of ... and the pathological, the relation of individual development and cultural history, the nature of explanation and evidence, the two faces of many emotions (including jealousy and pride), and the...

Ngày tải lên: 10/06/2014, 21:33

351 756 0
w