application of a theoretical foundation to the business practices of seaports

T-­Shirts and Suits A Guide to the Business of Creativity pptx

T-­Shirts and Suits A Guide to the Business of Creativity pptx

... creativity in a pure way, free of the constraints and pressures of business Perhaps it is better to separate earning a living on the one hand and creativity on the other so as to each one to the ... Chan, Chairman of Shanghai­based computer games manufacturer Shanda Entertainment, operates in a culture where pirating software is rife Software pirating was a threat but he turned it into an ... Shanda changed their business model so that clients have to pay to play games online So the distribution of pirate copies of the software actually encourages more people to log on and become paying...

Ngày tải lên: 15/03/2014, 21:20

117 487 0
A thesis submitted to the College of Business In partial fulfillment of the requirements for the degree Master of Science (International Accounting) University Utara Malaysia

A thesis submitted to the College of Business In partial fulfillment of the requirements for the degree Master of Science (International Accounting) University Utara Malaysia

... make other use of material in this thesis in whole or in part should be addressed to: Dean (Research and Post Graduate) Universiti Utara Malaysia 06010 UUM Sintok Kedah Darul Aman Malaysia ABSTRACT ... through distance education via Inter- and Intranet pedagogy PASAA, 31, July 2001, 75-81 Prapphal, K and Opanon-amata, P (2002) An investigation of English proficiency of Thai graduates Research Report ... is also understood that due recognition shall be given to me and to the Universiti Utara Malaysia for any scholarly use which may be made of any material from my thesis Request for permission to...

Ngày tải lên: 10/12/2016, 17:11

17 431 0
A Guide to the Business Analysis Body of Knowledge v2

A Guide to the Business Analysis Body of Knowledge v2

... is a set of changes to the current state of an organization that are made in order to enable that organization to meet a business need, solve a problem, or take advantage of an opportunity The ... and an analysis of the impact of the change not only to the project, but also to other business and automated systems In practice, the number and impact of change requests often increases towards ... completion of a task Although a particular output is created and maintained by a single task, a task can have multiple outputs An output may be a deliverable or be a part of a larger deliverable The...

Ngày tải lên: 14/04/2017, 11:37

271 505 1
A Guide to the Business Analysis Body of Knowledge

A Guide to the Business Analysis Body of Knowledge

... necessary knowledge area Theoretically, one gathers requirements then analyzes and documents them, then uses them as input into the designs that lead to the final implementation of the gathered and ... Managers of Business Analysis Professionals • Business Analysis Professionals • Project managers • Educators and Trainers teaching Business Analysis and related topics • Consultants and other specialists ... faced by the organization and the potential areas of study required to address the issues The analyst then conducts root cause analysis to determine the full nature of the problem, the actual...

Ngày tải lên: 14/04/2017, 11:37

329 509 0
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx

Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx

... calculated as 82 It is unclear, but Fabiani et al (1996) and Fabiani et al (2000) appear to report the same participants Karwautz at al (2008) and Wagner et al (2008) report the same participants, ... follow a GFD (Mihailidi, Paspalaki, Katakis, & Evangeliou, 2003) The risk of cancer decreases to the same as a person without CD after a GFD has been followed for to years (Coeliac UK, 2007) In addition ... such a feature, indicates partial evidence, and indicates there was definitely evidence for such a feature in the study A further adaptation was sorting of the categories to be scored As the studies...

Ngày tải lên: 12/02/2014, 12:20

171 709 0
Tài liệu A Historical Primer on the Business of Credit Ratings docx

Tài liệu A Historical Primer on the Business of Credit Ratings docx

... was America The role of World War I and the breakdown of the classical gold standard was taken over by the Cold War and the breakdown of the Bretton Woods System The latter’s replacement by a ... issues had to be marked to market, and the capital loss had to be charged against a financial institution’s surplus account This meant, said Hickman, that the surplus accounts of the financial intermediaries ... financ ial corporations The total par value of the straight corporate bonds issued during the 44 years of the study came to $71.5 billion; of that amount, 93 percent was in the form of regular offerings,...

Ngày tải lên: 16/02/2014, 03:20

30 612 1
Tài liệu The Guide to the Business Analysis Body of Knowledge™: Version 2.0 Framework pptx

Tài liệu The Guide to the Business Analysis Body of Knowledge™: Version 2.0 Framework pptx

... control The form of an output is dependent on the type of initiative underway, standards adopted by the organization, and best judgement of the business analyst as to an appropriate way to address the ... Malcolm Eva Cherifa Liamani Jason Questor IIBA, the IIBA logo, BABOK and Business Analysis Body of Knowledge are trademarks owned by the International Institute of Business Analysis CBAP is a ... Jim Subach Jake Calabrese Brenda Kerton Meilir Page-Jones Diane Talbot Gerrie Caudle Day Knez Harish Pathria Steve Tockey Bruce Chadbourne Barbara Koenig Laura Paton Krishna Vishwanath Carrollynn...

Ngày tải lên: 17/02/2014, 21:20

16 813 3
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

... from the RNase A deamidation samples of Fig Deamidation at an individual residue of a specific product causes a Da increase in any fragment ion containing that residue The average mass gain of N-terminal ... on the molecular mass value of HAD was measured; instead of an adduct increase, or no change, the value had unexpectedly decreased from 22 417.0 Da to 22 413.2 Da, a loss of Da MS ⁄ MS of these ... YjbV fragment peaks The ‘) 20 ’ after the molecular mass value signifies that the main component ion of the most abundant isotopic peak contains 20 13C atoms and has this mass value of identification...

Ngày tải lên: 18/02/2014, 16:20

13 572 0
Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

... decided to use the hierarchical clustering algorithm readily available in the MATLAB (MATrix LABoratory) programming language After some testing with various similarity functions and linkage types, ... in such a way that line crossings are avoided when connecting clusters As we can see, the dissimilarities among the top 30 associations to palm are all in the upper half of the scale and not ... words that are in the middle of the frequency range Figures to are based on the association lists for the words palm and poach Given that our term/context matrices are very sparse with each of their...

Ngày tải lên: 20/02/2014, 16:20

4 537 0
Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot

Fundamentals of NGO Management: A Practical Guide to the Financial Management of NGOs pot

... financial year • records of statutory payments made, particularly on staff salaries • details of all assets The auditor may also ask to see: • a list of accruals – income the organisation has ... /21.67       total amount due Fundamentals of NGO Management Sick Annual Taken Annual leave days remaining 47 Fundamentals of NGO Management Annex 20: Honoraria agreement Name of organisation: An ... money) at the end of the financial year • a list of debtors (everyone by whom the organisation was owed money) at the end of the financial year • a list of creditors and debtors from the end of the...

Ngày tải lên: 06/03/2014, 21:20

76 579 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... al A B C D other Statistical analysis (Student’s t-test) between the MR-1R values and the sum of the values of the omcA– and the omcB– mutants revealed that there is no statistically significant...

Ngày tải lên: 07/03/2014, 09:20

11 732 0
Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf

Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf

... Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix An appropriate algebraic method that has the capability to reduce the dimensionality of a ... clusters are much more salient Also, widely and rural are well within the adjective cluster The comparison of the two dendrograms indicates that the SVD was capable of making appropriate generalizations ... with our algorithms (SVD and clustering), we decided to restrict the number of rows to a vocabulary appropriate for evaluation purposes Since we are not aware of any standard vocabulary previously...

Ngày tải lên: 08/03/2014, 04:22

4 433 0
A further contribution to the study of the mortuary customs of the North American Indians docx

A further contribution to the study of the mortuary customs of the North American Indians docx

... layer of Dall] There are some crania found by us in the lowermost part of the Amaknak cave and a cranium obtained at Adakh, near the anchorage in the Bay of Islands These were deposited in a ... Indians he learned that tradition among the Aleuts assigned Kagamale, the island in question, as the last resting-place of a great chief, known as Karkhayahouchak Last year the captain was in the ... ceases, at the end of the year, they have high mass said for the benefit of the soul of the departed; after this they again appear upon the arena of their wild sports and continue to be gay and happy...

Ngày tải lên: 08/03/2014, 13:20

108 604 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... i,e, the morphemes are in the right order and the relevant phonological rules have applied correctly over the appropriate domains n we then pass the morphological analysis off to the syntactic parser ... well-formed Also exemplary of the division of duty between the morphophonological parser and the syntactic parser is the dual status of subcategorization in Warlpiri For example, the ergative case suffix...

Ngày tải lên: 08/03/2014, 18:20

8 522 0
Small Business Survival: A Joint Report to the Governor pot

Small Business Survival: A Joint Report to the Governor pot

... Climate Rankings State Alabama Alaska Arizona Arkansas California Colorado Connecticut Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts ... States: Minnesota, Washington, Colorado, Delaware, Oregon Bottom Five States: West Virginia, Oklahoma, Mississippi, Alabama, Louisiana Washington’s Rank: Explanation of Washington’s Rank: Washington ... This is a national pattern as well, according to the literature Small firms are more critical to the rural economy than they are to the urban economy 61% SAN JUAN WAHKIAKUM COLUMBIA ISLAND PACIFIC...

Ngày tải lên: 16/03/2014, 01:20

38 278 0
w