... Szymczak, Alexander I Voitenko , Masaru Kato, Takekazu Ishida, Tomio Koyama, Masahiko Machida, Florian Loder, Arno P Kampf, Thilo Kopp, C .A. C Passos, M S Bolzan, M.T.D Orlando, H Belich Jr, J.L Passamai ... Structures of d-Wave and s-Wave Superconductors (d-Dot): Analysis Using Two-Component Ginzburg-Landau Equations Masaru Kato, Takekazu Ishida, Tomio Koyama and Masahiko Machida 319 Chapter 14 Flux-Periodicity ... undergraduates, postgraduates and professionals as a collection of important results and deep thoughts in the vast field of superconductivity Alex Gabovich Leading Research Associate of Crystal Physics...
Ngày tải lên: 29/06/2014, 13:20
... condensation of a molecule of b-alanine with a molecule of pantoate in an ATP-dependent manner to form pantothenate [1,2] Pantothenate itself is an important cofactor that is essential for CoA biosynthesis, ... Gopalakrishnan B, Aparna V, Jeevan J, Ravi M & Desiraju GR (2005) A virtual screening approach for thymidine monophosphate kinase inhibitors as antitubercular agents based on docking and pharmacophore ... atom of pantoate and the Nf atom of the side chain of Lys39 However, there are a large number of water-mediated networked interactions that stabilize the pantoate at site II The backbone carbonyl...
Ngày tải lên: 16/02/2014, 09:20
Báo cáo khoa học: 15 N-Labelled proteins by cell-free protein synthesis Strategies for high-throughput NMR studies of proteins and protein–ligand complexes doc
... incorporation of 15N and 13C for assignment and interpretation of nuclear magnetic resonance spectra of proteins Q Rev Biophys 23, 1–38 Yamazaki T, Yoshida M, Kanaya S, Nakamura H & Nagayama K (1991) ... reactions that would otherwise obscure the labelling pattern Thus, an early attempt of combinatorial labelling in vivo had to exclude glutamine, glutamate, asparagine and aspartate from the labelling ... five samples are prepared with different combinations of [15N]-labelled amino acids The most abundant amino acids are labelled in only one of the samples, while the least abundant amino acids are...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc
... Oliveira FW, Chavante SF, Santos EA, Dietrich CP & Nader HB (1994) Appearance and fate of a beta- 13 14 15 16 17 18 19 20 21 22 23 galactanase, alpha, beta-galactosidases, heparan sulfate and chondroitin ... repeat region of CS is a repeating disaccharide of glucuronic acid (GlcA) and N-acetylgalactosamine (GalNAc) [-4)GlcA(b1– 3)GalNAc(b1-]n, which may be O-sulfated on the C4 and ⁄ or C6 of GalNAc and ... 3.677 3.677 2.037* GalNAc (E) Hexasaccharides Although data from disaccharides, trisaccharides and tetrasaccharides are valuable for the detailed structural characterizations of unknown segments...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khóa học: C-, 15N- and 31P-NMR studies of oxidized and reduced low molecular mass thioredoxin reductase and some mutant proteins docx
... and an eluent containing mM ammonium acetate in 25% methanol Riboavin, FMN and FAD had retention volumes of 44 mL, 10 mL and mL, respectively 5Â-TCAGAATTCCATGGATATTTGGTA CGG-3Â 5Â-GGCCAACGCAAAGGGATCCTCGAT ... from the National Institute of General Medical Sciences (to C H W.) and by the Health Services and Research Administration of the Department Administration of the Department of Veteran Aairs (to ... nitrogen atoms, N(1) and N(3), are the least affected and resonate at elds comparable to those of TARFH2 The 15N chemical shift of the N(1) atom differs greatly from that of ionized reduced avin (Table...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: High-resolution NMR studies of the zinc-binding site of the Alzheimer’s amyloid b-peptide pdf
... Tanemura K, Murayama O, Akagi T, Murayama M, Sato S, Sun X, Tanaka N & Takashima A (2001) New insights on how metals disrupt amyloid beta-aggregation and their effects on amyloid-beta cytotoxicity ... exhibit a total loss of H6 and H14 resonances, and a weak H13 resonance remains at the same chemical shift The tyrosine aromatic crosspeaks are unaffected upon zinc addition B A H13 H6 FEBS Journal ... terms of a first-order binding process An apparent dissociation constant appKd* can be calculated; the star indicates that the dissociation A Y10 Y10 B Fig 1H–13C HSQC spectra of the aromatic regions...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo khoa học: P NMR studies of energy metabolism in xanthosine5¢-monophosphate overproducing Corynebacterium ammoniagenes pot
... in the phase I Intracellular ATP and ADP concentrations in phase I were estimated based on 31P NMR data The data shown are the mean ± SD Fig Changes in cellular ATP, ADP and ATP/ADP of the XMP ... phase (A) Cellular ATP (s) and ADP (d) concentrations are shown (B) Cellular NADP (j) is shown To quantify the intracellular metabolites, MDP was used as a concentration standard in the NMR All ... intracellular metabolites, NADP was used as a concentration standard in the NMR Partially relaxed 8,9 MDP was used to estimate metabolite concentrations ND, not determined Values are the mean ± SD Average...
Ngày tải lên: 23/03/2014, 17:22
Tài liệu Báo cáo khoa học: Mechanism of dihydroneopterin aldolase NMR, equilibrium and transient kinetic studies of the Staphylococcus aureus and Escherichia coli enzymes docx
... the production of a Histagged SaDHNA The primers for the PCR were 5¢-GG AATTCCATATGCAAGACACAATCTTTCTTAAAG-3¢ (forward primer with a Nde I site) and 5¢-CGGGATCCT CATTTATTCTCCCTCACTATTTC-3¢ (reverse ... The Authors Journal compilation ª 2007 FEBS 2249 Mechanism and kinetics of dihydroneopterin aldolase Y Wang et al 5¢-GGAATTCCATATGGATATTGTATTTATAGAGCA AC-3¢ (forward primer with a Nde I site) and ... Y Wang et al Fig Global analysis of the quench-flow data of the SaDHNA-catalyzed reaction Data 1, 2, 3, 7, 8, and 11 were obtained with DHNP as the substrate Because the commercial DHNP contained...
Ngày tải lên: 19/02/2014, 00:20
Báo cáo khoa học: NMR and molecular dynamics studies of an autoimmune myelin basic protein peptide and its antagonist Structural implications for the MHC II (I-Au)–peptide complex from docking calculations ppt
... demonstrate the structural importance of the nature of the amino acid at position 81 of the encephalitogenic sequence 74–85 of guinea MBP: replacement of Asp81 with an alanine seems to break a chain ... 3.0: a package for molecular simulation and trajectory analysis J Mol Model 7, 306–317 50 Daura, X., Mark, A. E & Van Gunsteren, W.F (1998) Parameterization of aliphatic CHn united atoms of GROMOS96 ... Lys75–Glu82 fragment of 1.05 ± 0.40 A ˚ and 2.05 ± 0.60 A for backbone N, Ca, C¢ atoms and all heavy atoms, respectively As was the case in water, the key characteristic of the structure of the native...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... increasing amounts of some sugars Peak movements of main chain amide and amide proton of Asp18, and side chain amide and amide proton (marked by ‘sc’) of Trp33 in EW29Ch during the titration of lactose ... binding of each of sugar; lactose, melibiose, galactose (all from Wako Chemicals, Tokyo, Japan), a- Me-Gal and b-Me-Gal (both from Seikagaku Co., Tokyo, Japan), to EW29Ch at 25 °C (pH 6.1) was measured ... Gaussian-shaped pulses for saturation with ms intervals and a total saturation time of s On-resonance irradiation of the protein was conducted at a chemical shift of –0.4 p.p.m and off-resonance...
Ngày tải lên: 23/03/2014, 04:21
Structural and equilibrium unfolding studies of sam domain of DLC1 by NMR spectroscopy
... Thanks to Associate Professor Low Boon Chuan and Zhong Dandan for their help as collaborators Thanks to Assistant Professor Liang Zhao-Xun, Dr Nikolay Korolev and Abdollah Allahverdi in Nanyang ... coherences (Cavanagh 2007) Analysis of the relaxation of a system provides a great deal of information about the geometry and dynamics of the system In addition, the relaxation constants determine ... both mammalian cells and yeast (Zhang et al 2000) An intact PNT domain (moniker of SAM domain) of Ets2 specifically recognized a Cdc2-related kinase, Cdk10 (Kasten and Giordano 2001) In addition,...
Ngày tải lên: 14/09/2015, 14:04
Báo cáo y học: "Medical resource utilization among patients with ventilator-associated pneumonia: pooled analysis of randomized studies of doripenem versus comparators"
... data in the pooled analysis, included durations of mechanical ventilation, ICU stay, and hospitalization Duration of mechanical ventilation was defined as stop date - maximum (start date or randomization ... because they had valid ICU admittance dates but no valid ICU discharge dates and had hospital discharge dates (doripenem, 3; comparator, 6) Duration of hospitalization was defined as (discharge ... (discharge date or death date) - randomization date + If discharge date was not available, patients were censored at late follow up In addition, all-cause overall mortality and, in patients with P aeruginosa...
Ngày tải lên: 25/10/2012, 10:02
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"
... in auditory, visual, and somatosensory domains may fall under the integrated purview of the MMN, N2b, and P300 phenomena Future applications of ERP analysis as a psychological diagnostic and ... the basal ganglia, as well as clinically-evident dysfunction of the superficial cerebral cortex, associated in particular Int J Med Sci 2005 with spreading and advanced disease For instance, anterior ... similar oddball paradigm using short inter-stimulus intervals, however, MMN latency and amplitude varied little as a result of increasing age, suggesting the invariance of automatic stimulus analysis...
Ngày tải lên: 02/11/2012, 11:08
Tài liệu SURVEY OF CASE STUDIES OF THE USE OF KNOWLEDGE MANAGEMENT IN SOFTWARE ENGINEERING docx
... use of a tool and experience with it Management Packages reference information for project managers Data Packages data relevant for a software project or its activities Can be project databases ... information that was already documented in the company, and to make it available and searchable, a kind of a bottom up way to start a knowledge management program The article then reports the usage ... indicates that estimation accuracy has improved, and focus on risk management has increased Ericsson Software Technology The company claims that the initiative was "more valuable" than a database...
Ngày tải lên: 16/01/2014, 16:33
Tài liệu STUDIES OF AMERICAN FUNGI, MUSHROOMS, EDIBLE, POISONOUS, ETC ppt
... Chemistry and Toxicology of Mushrooms, and Characters of Mushrooms, to which their names are appended, and also to Dr Chas Peck, of Albany, N Y., and Dr G Bresadola, of Austria-Hungary, to whom some of ... on our part, as well as some experience in judging of the value of such characters; the same habit of observation and discrimination we apply to everyday affairs and to all departments of knowledge ... surface are silky or tomentose threads not much elevated from the surface, and as the plant ages these are drawn into triangular scales which are easily washed apart by the rains The color is tawny...
Ngày tải lên: 13/02/2014, 12:20
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx
... I, Pimkhaokham A, Nakagawa T, Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007) PRTFDC1, a possible tumor-suppressor gene, is frequently silenced in oral squamous-cell carcinomas by aberrant promoter ... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phosphoribosyltransferases is examined using saturation mutagenesis, functional analysis, and X-ray ... regulatory ligands for PRTFDC1 The catalytic efficiency and substrate specificity of PRTFDC1 was further characterized using a radiochemical assay with tritium-labeled bases as substrates, whereas...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus doc
... Authors Journal compilation ª 2009 FEBS 509 Pyruvate synthesis by pyruvate oxidoreductase T Ikeda et al 34 Ozawa Y, Nakamura T, Kamata N, Yasujima D, Urushiyama A, Yamakura F, Ohmori D & Imai T (2005) ... enzyme activity of the recombinant LDH was assayed at 70 °C by monitoring the lactate-dependent NADH oxidation as the decrease in A3 40 The standard assay mixture contained mm lactate, 0.2 mm NADH and ... (Fig 1, dashed arrow) The reaction rate of this coupled assay was significantly affected by the concentration of CoA (Fig 2B) Although CoA was an essential substrate of this assay, pyruvate synthesis...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
... (in Japanese) IPCS (1989) Environmental Health Criteria 89 Formaldehyde, World Health Organization, Geneva Takeda, M., Saijo, Y., Yuasa, M., Kanazawa, A. , Araki, A and Kishi, R (2009) Relationship ... Indoor Air Quality Indoor Environ., 1, 27–34 (in Japanese) 126) Kishi, R., Saijo, Y., Kanazawa, A. , Tanaka, M., Yoshimura, T., Chikara, H., Takigawa, T., Morimoto, K., Nakayama, K and Shibata, E (2009) ... Environmental Health Criteria 186 Ethylbenzene, World Health Organization, Geneva 84) Saijo, Y., Kishi, Y., Sata, F., Katakura, Y., Urashima, Y., Hatakeyama, A. , Kobayashi, S., Jin, K., Kurahashi,...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... 5¢-TGGGCCATGCCCTTTAACAGTTATGTCACG CTG-3¢ Q81N-rev: 5¢-CAGCGTGACATAACTGTTAAA GGGCATGGCCCA-3¢ R105H-fwd: 5¢-GCTAAAAATAA R105HTGGAGCACTCCATTTTTAGCGCTCGC-3¢ rev: 5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTAT TTTTAGC-3¢ ... TTTTAGC-3¢ R105K-fwd: 5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢ R105K-rev: 5¢-GCG AGCGCTAAAAATGGATTTCTCCATTATTTTTAGC-3¢ Sequence verification Plasmids of the seven mutants were transformed into XL1Blue ... 5¢-GCCTGCTGACCCAGCCCGTCGAGAAGTGG CGC-3¢ E52Q-rev: 5¢-GCGCCACTTCTCGACGGGCTG GGTCAGCAGGC-3¢ Y70W-fwd: 5¢-CTGCTGGAGCT GATGTGGAAAGATCCCAAGAAG-3¢ Y70W-rev: 5¢-CTT CTTGGGATCTTTCCACATCAGCTCCAGCAG-3¢ Q81Nfwd:...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae docx
... List of PCR primers Restriction sites are underlined No Sequence GCTTTTAAAGTTGACTTCAAAG CTTTGAAGTCAACTTTAAAAGC CTACCATGGCACCTCCTTCTTCTTTCTCAA GCTGTCGACTTATTTAGTGCATGCTTTATAAACAA CTACCATGGCCCCCATCTCTTTTAGTCAT ... possible that the enzymes also have adapted strategies to remove Na+ around the phosphates of DNA before catalysis can take place It seems clear that the saltadapted and cold-adapted properties of VsEndA ... were assayed using the modified Kunitz assay Each replicate is plotted and the mean values are drawn Table VsEndA possesses a higher kcat than VcEndA at all temperatures, and the Km values of VcEndA...
Ngày tải lên: 19/02/2014, 05:20