... these Hb variants are inherited in an autosomal dominant manner High affinity Hb variants release oxygen in the tissue relatively slowly and create relative tissue hypoxia This leads to increased ... band anodal to Hb A and globin chain analysis by HPLC revealed an unidentified beta globin variant in both subjects (Figure 1) Peptide mapping showed an extra peak at 26.9 but showed no decrease ... the tissue is reestablished and Epo production plateaus and at this new steady state serum Epo is often at normal level This leads to stabilization of Hb level after achieving a certain elevated...
Ngày tải lên: 08/08/2014, 16:23
... effective and safe in treating trypanosomiasis in cattle and buffaloes 22 + Examination and treatment for trypanosomiasis in buffaloes and cattle infected with T evansi in summer and Autumn in order ... outbreak of trypanosomiasis and mortality rates of buffaloes and cattle in Winter and Spring Exterminating sucking flies and gad flies that transmit tripanosomiasis - Exterminating flies and gad ... (using trypamidium samorin) in treating trypanosomiasis in buffaloes and cattle During the treatment let the affected animals stay in their stable for - days and having good feeding ring and management...
Ngày tải lên: 28/04/2014, 13:08
Báo cáo hóa học: " The synergistic effect of IFN-α and IFN-γ against HSV-2 replication in Vero cells is not interfered by the plant antiviral 1-cinnamoyl-3, 11-dihydroxymeliacarpin" pptx
... CDM IFNIFN- al pha CDM + al pha gamma CDM +gamma alpha+gamma + - al pha + - CDM + al pha + + - gamma + CDM +gamma alpha+gamma + + + CDM +a+ g (d) 10 00 1000 00 Fold Inhibition Fold Inhibition 00 ... herpetic infection in female mice infected intravaginally with HSV-2 was also ameliorated by MA treatment [10] On the other hand, besides its broad effect of antiviral action, meliacine acts as an ... necrosis factor alpha Fitoterapia 2003, 74:77-83 Ellerman-Eriksen S: Autocrine secretion of interferon-alpha/ beta and tumor necrosis factor-alpha synergistically activates macrophages after infection...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo lâm nghiệp: " Partitioning of remobilised N in young beech (Fagus sylvatica L.) is not affected by elevated [CO2]" ppsx
... to indicate a trend RESULTS AND DISCUSSION Carbon uptake during the experiment was significantly increased under elevated [CO2], as was indicated by the increase in RSA of new C in the elevated ... persica [14] Marmann et al [8] showed that in Fraxinus excelsior N was mainly stored in the roots, whereas our data indicate that in beech N stocks in coarse roots and stem contributed about the same ... concentration in the aboveground compartments under elevated [CO2] (data not shown) These data might indicate that N demand was increased for root growth to increase N uptake and as a consequence...
Ngày tải lên: 08/08/2014, 00:21
Báo cáo sinh học: "Post-ERCP bacteremia caused by Alcaligenes xylosoxidans in a patient with pancreas cancer" pps
... the intestines A. xylosoxidans is a weakly virulent microorganism In general, there is an underlying dissease in patients A. xylosoxidans have been reported in patients with cancer, neutropenia, ... extends the clinical spectrum of this rare pathogen This unusual case highlights that an effective antimicrobial therapy based on an immediate microbiologycal analysis may be life-saving in patients ... one associated with A. xylosoxidans that causes post-ERCP bacteremia Table 1: Key characteristics of A. xylosoxidans Tests Oxidase Catalase OF xylose OF glucose Arginine Citrate Ketoglutaric acid...
Ngày tải lên: 08/08/2014, 19:20
Báo cáo y học: "Synovial expression of IL-15 in rheumatoid arthritis is not influenced by blockade of tumour necrosis factor" docx
... in maintaining T cell activation [9] Because IL-15 might have a central role in sustaining inflammation in RA, this cytokine has been considered as a potential therapeutic target in RA Both a ... are intracellularly stained with this antibody In addition, more cells are stained with 2C8 than with mAb1 and mAb11, indicating that staining with 2C8 is more sensitive than staining with mAb1 ... morphology was selected for subsequent immunohistochemical staining The staining was always performed in pairs before and after treatment infliximab, allowing a pairwise comparison Materials and methods...
Ngày tải lên: 09/08/2014, 07:20
báo cáo khoa học: " Innegligible musculoskeletal disorders caused by zoledronic acid in adjuvant breast cancer treatment: a meta-analysis" pptx
... D, Valachis A, Polyzos NP, Tsali L, Mavroudis D, Georgoulias V, Casazza G: Does adjuvant bisphosphonate in early breast cancer modify the natural course of the disease? A meta-analysis of randomized ... G, Papadiamantis J, Zobolas V, Misitzis J, Kalogerakos K, Sarantopoulou A, Siasos N, Koukouras D, Antonopoulou Z, Lazarou S, Gogas H: Management of anastrozole-induced bone loss in breast cancer ... Cite this article as: Zhou et al.: Innegligible musculoskeletal disorders caused by zoledronic acid in adjuvant breast cancer treatment: a metaanalysis Journal of Experimental & Clinical Cancer...
Ngày tải lên: 10/08/2014, 10:21
báo cáo khoa học: "Lobar pneumonia caused by Ralstonia pickettii in a sixty-five-year-old Han Chinese man: a case report" doc
... this case report and accompanying images A copy of the written consent is available for review by the Editor -in- Chief of this journal Abbreviations CLSI: Clinical and Laboratory Standards Institute; ... this article as: Pan et al.: Lobar pneumonia caused by Ralstonia pickettii in a sixty-five-year-old Han Chinese man: a case report Journal of Medical Case Reports 2011 5:377 • Immediate publication ... Infect 2005, 60:51-55 Labarca JA, Sader HS, Peterson CL, Carson LA, Holt SC, Arduino MJ, Meylan M, Mascola L, Jarvis WR: A multistate nosocomial outbreak of Ralstonia pickettii colonization associated...
Ngày tải lên: 10/08/2014, 22:24
báo cáo khoa học: " A nodulo-cystic eumycetoma caused by Pyrenochaeta romeroi in a renal transplant recipient: A case report" docx
... doi:10.1186/1752-1947-5-460 Cite this article as: Mathuram Thiyagarajan et al.: A nodulo-cystic eumycetoma caused by Pyrenochaeta romeroi in a renal transplant recipient: A case report Journal of Medical Case Reports ... were involved in drafting the manuscript MLN revised the manuscript All authors have read and approved the final manuscript All three were involved as part of team management Competing interests ... histopathological appearance of this lesion was closely similar to those caused by Exophiala jeanselmei or Phialophora richardsiae Microscopy showed dematiaceous hyphae with yeast-like cells and...
Ngày tải lên: 10/08/2014, 23:20
báo cáo khoa học: "Severe sepsis caused by Aeromonas hydrophila in a patient using tocilizumab: a case report" pps
... biliary tract caused sepsis with ascending infection of Klebsiella pneumoniae No other infectious pathway seems likely In healthy individuals, bacteria are not found in the gall bladder, but in patients ... hydrophila was resistant to penicillin, ampicillin, ampicillin-sulbactam, and first- and second-generation cephalosporins, and susceptible to piperacillin, third-generation cephalosporins, aminoglycosides, ... hydrophila in a patient using tocilizumab: a case report Journal of Medical Case Reports 2011 5:499 Conclusion We present a rare case of A hydrophila sepsis and acute suppurative cholangitis in a patient...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: " Liver and brain abscess caused by Aggregatibacter paraphrophilus in association with a large patent foramen ovale: a case report" pps
... this article as: Ariyaratnam et al.: Liver and brain abscess caused by Aggregatibacter paraphrophilus in association with a large patent foramen ovale: a case report Journal of Medical Case Reports ... (approx 12 mm diameter) Plain abdominal radiography confirmed a dense radio-opaque object consistent with amalgam dental filling in the right lower quadrant A percutaneous pigtail drain was inserted ... guidance after six days This drained 30 ml of pus from our patient Gram stain showed no organisms and culture was negative He continued to have upper abdominal pain and high fever A repeat abdominal...
Ngày tải lên: 11/08/2014, 11:23
Báo cáo y học: " Haemoptysis in pregnancy caused by a well-differentiated fetal adenocarcinoma: a case report" docx
... exertion Discussion Well-differentiated fetal adenocarcinoma (WDFA) is classified by the World Health Organisation as a variant of adenocarcinoma When fetal adenocarcinoma is associated with ... 36-year-old woman with hemoptysis and a lung mass months after delivery Chest 2006, 130:1620-1623 Nakatani Y, Masudo K, Nozawa A, Inayama Y, Yamanaka S, Ito T, Kitamura H, Notohara K, Kashima K, ... primitive blastemal stroma, it is classified as a pulmonary blastoma In this case, there was only a microscopic focus of blastomatous tissue, so we were not totally certain that the categorisation into...
Ngày tải lên: 11/08/2014, 14:21
Báo cáo y học: " Neuropathy caused by B12 deficiency in a patient with ileal tuberculosis: A case report" doc
... nurture in vitamin B12 deficiency Archives of Disease in Childhood 2002, 87:75-76 Akaike A, Tamura Y, Sato Y, Yokota T: Protective effects of a vitamin B12 analog, methylcobalamin, against glutamate ... tuberculosis, regional enteritis and Whipple's disease, can cause macrocytic anemia without any other manifestations of intestinal malabsorption such as steatorrhea [5,6] Our diagnosis was supported by ... neutrophils (6 and segments) Case presentation A 14-year-old girl presented with complaints of fatigue, inability to walk, urinary incontinence, dysarthria, and ataxia that had worsened in the last three...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: " Infective endocarditis caused by Staphylococcus aureus in a patient with atopic dermatitis: a case report" potx
... Erythematous macular non-blanching skin rash Erythematous macular non-blanching skin rash S aureus is an aggressive pathogen and bacteremia with this organism can infect healthy heart valves Neurological ... Endocarditis in Adults N Engl J Med 2001, 345:1318-1330 Harada M, Nishi Y, Tamura S, Iba Y, Abe K, Yanbe Y, Akimoto T, Takao N, Watanabe S, Hayashida N, Koyanagi H: Infective endocarditis with a ... predominant organism in the atopic lesions and constituted 91% of the total aerobic bacterial flora Coagulase-negative staphylococci are the second predominant organisms (9%) isolated from the skin...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
... sequences are listed in Table Available online http://ccforum.com/content/10/5/R139 Table Locus DDAHII-449 Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC ... Table Table Correlation matrix of asymmetrical dimethyl arginine (ADMA) and inflammatory markers Variation in asymmetrical dimethyl arginine (ADMA) levels with carriage of specific alleles at ... percentages in parenthesis or as medians with interquartile ranges in parenthesis IL6 was measured in pg/ml, asymmetrical dimethyl arginine (ADMA) in µmol/l, lactate in mmol/l, and mean arterial pressure...
Ngày tải lên: 13/08/2014, 03:20
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
... does not translate into an enhanced viral gene expression in this primary cell type, and already macrophages from n-tg rats are at a level comparable to human MDM This may, in part, relate to ... Tcells analyzed in parallel, while the latter typically showed a faster kinetic (Fig 8A and data not shown) Parallel sampling of culture supernatants and p24 quantification, however, revealed a key ... major HIV target population As reported, early HIV-1NL4-3 gene expression was comparable and statistically indistinguishable for infected macrophages derived from n-tg rats and MDM from human...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
... consists of a monolayer of inner circular muscle, which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa ... preserved because the patient had hemoperitoneum In addition, the remaining colon wall was normal, but the bowel preparation was poor The invagination of diverticulum has an advantage over diverticulectomy ... Schumpelick V Increased distribution of collagen type III and reduced expression of matrix metalloproteinase in patients with diverticular disease Int J Colorectal Dis 2001;16:271-5 Cortesini C, Pantalone...
Ngày tải lên: 25/10/2012, 10:51
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot
... Theoretical approach mathematical simulation of some metabolic pathways related to adenine nucleotide metabolism This was a theoretical approach The simulation was started by stating the metabolic pathways ... degradation and the appearance of intermediate products were essentially the same in both cases and, above all, no appreciable differences in the rates of disappearance of ATP or appearance of Ino ... 5Ânucleotidase), E3 (AMP deaminase), E4 (adenosine deaminase), E5 (purine nucleoside phosphorylase), E6 (adenylate kinase), E7 (adenosine kinase), E8 (a hypothetical enzyme catalyzing two general and...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo "The dependence of the nonlinear absorption coefficient of strong electromagnetic waves caused by electrons confined in rectangular quantum wires on the temperature of the system" doc
... embedded in GaAlAs The carriers (electron gas) are assumed to be confined by an infinite potential in the ( x, y ) plane and are free in the z direction in Cartesian coordinates ( x, y , z ) The laser ... respectively, this fact was not seen in bulk semiconductors[9] as well as in quantum wells[10], but it fit the case of linear absorption [8] Conclusion In this paper, we have obtained analytical expressions ... electrons in rectangular quantum wires on the temperature T is complex and nonlinear In addition, from the analytic results, we also see that when the term in proportional to quadratic the intensity...
Ngày tải lên: 22/03/2014, 11:20
Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt
... #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated ... (Mountain View, CA, USA) siRNA sequences are: ZIP8 #1, accuaaagca uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ... diseases BioEssays 25, 1085–1095 Namura S, Iihara K, Takami S, Nagata I, Kikuchi H et al (2001) Intravenous administration of MEK inhibitor U0126 affords brain protection against forebrain ischemia...
Ngày tải lên: 23/03/2014, 06:20