animation along a complex path with auto rotation

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...

Ngày tải lên: 07/03/2014, 12:20

11 550 0
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot

Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot

... each lane and the gel was stained with silver 11 M, Bio-Rad broad molecular mass standard (Bio-Rad Laboratories AG, Reinach, Switzerland); 1, a- 2 ⁄ c¢-2 complex purified by Ni2+– NTA; 2, wash fraction ... expression of oadA-2 with an N- or C-terminal His tag oadA-2 was amplified from pET24-VcoadGAB-2 harbouring the oad-2 genes, with the oligonucleotide primers VcoadA2_for and VcoadA2_rev containing an NdeI ... Astonishingly, the mutant a- 2-C-D50 9A affected complex formation with c¢-2 only marginally although the mutant a- 2-C-D509N had a major destabilizing impact on complex formation As the mutation D509N is...

Ngày tải lên: 23/03/2014, 13:20

10 333 0
Báo cáo khoa học: Hemagglutinin-33 of type A botulinum neurotoxin complex binds with synaptotagmin II potx

Báo cáo khoa học: Hemagglutinin-33 of type A botulinum neurotoxin complex binds with synaptotagmin II potx

... Biotechnologies) and goat anti-mouse IgG alkaline phosphatase conjugate (Novagen, Madison, WI, USA) were used as primary and secondary antibodies The absorbance was measured using a microplate reader (GMI, ... molecular masses of approximately 90, 55, 50 and 45 kDa Western blot analysis using anti-synaptotagmin as the primary antibody revealed that one 65 kDa band from the 0.1 m NaCl eluate is synaptotagmin, ... nonspecific binding Goat anti-GST IgG (Amersham Pharmacia Biotech) and rabbit anti-goat IgG alkaline phosphatase conjugate (Sigma) were used as the primary and secondary antibodies, respectively...

Ngày tải lên: 23/03/2014, 13:20

10 475 0
Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx

Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx

... 5¢-ATTCTAGAG GCTAGGTTGTTGGAAAG-3¢, 5¢-ATTCTAGAGGAT GTCTTGAGCCCCTG-3¢ and 5¢-TTCTCGAGCAGGA CTGAGCATTAACAG-3¢ The two DNA fragments were ligated at the XbaI site and inserted into a cloning vector pBluescript ... domain was then amplified by PCR from the cloned plasmid with primers containing an EcoRI site at the 5¢ end (5¢-TAGAATTCCACCATGCAGGTCTCCCGT-3¢) and an EcoRV site at the 3¢ end (5¢-CAGATATCTTAACAGC ... N.I., Lasierra, P., Larrad, L., Pineiro, A. , Alava, M .A & Naval, J (1999) Activated human T cells release bioactive Fas ligand and APO2 ligand in microvesicles J Immunol 163, 1274–1281 27 Mather,...

Ngày tải lên: 24/03/2014, 03:21

10 517 0
Báo cáo khoa học: Homologous desensitization of guanylyl cyclase A, the receptor for atrial natriuretic peptide, is associated with a complex phosphorylation pattern pot

Báo cáo khoa học: Homologous desensitization of guanylyl cyclase A, the receptor for atrial natriuretic peptide, is associated with a complex phosphorylation pattern pot

... immunoprecipitation with anti-FLAG IgG Western blot analyses with antibodies against PMCA, as a marker for the cell membrane, and extracellular signalregulated kinase ⁄ (ERK1 ⁄ 2), as a marker for ... (21 aa) and an intracellular portion (567 aa), containing a kinase homology (KH) domain, the dimerization domain and the C-terminal catalytic GC domain [1,7] In the absence of ligand, GC -A forms ... concentrations are associated with significant changes in blood pressure [6] The GC -A receptor consists of an extracellular ligand-binding domain of approximately 441 amino acids (aa), a short membrane-spanning...

Ngày tải lên: 29/03/2014, 09:20

14 313 0
Báo cáo khoa học: The HS:1 serostrain of Campylobacter jejuni has a complex teichoic acid-like capsular polysaccharide with nonstoichiometric fructofuranose branches and O-methyl phosphoramidate groups pot

Báo cáo khoa học: The HS:1 serostrain of Campylobacter jejuni has a complex teichoic acid-like capsular polysaccharide with nonstoichiometric fructofuranose branches and O-methyl phosphoramidate groups pot

... H4 labeled A2 a, A2 b, A3 a, A3 b, A4 a and A4 b, respectively (Fig 4A) The 1D-NOESY of Gal H- 4a showed NOEs for Gal H- 2a, Gal H- 3a, Gal H-5 and Gal H-6 ⁄ 6¢, as well as for Fru H-4 and Fru H-6 ⁄ 6¢ ... 3JP,H of 11.1 Hz was observed CPS-2 Atom Type dH dC A1 A2 a A2 b A3 a A3 b A4 a A4 b A5 A6 ⁄ A6 ¢ B1 ⁄ B1¢ B2 B3 ⁄ B3¢ C1 ⁄ C1¢ C2 C3 C4 C5 C6 ⁄ C6¢ MeOPN C1 ⁄ C1 a C 2a C 3a C 4a C 5a C6 ⁄ C6 a CH CH CH CH ... H2O and purified using a SephadexÒ superfine G-50 column (Sigma, Oakville, Canada) equipped with a Waters differential refractometer (model R403, Waters, Mississauga, Canada) 1H NMR at 400 MHz (Varian,...

Ngày tải lên: 30/03/2014, 20:20

16 466 0
a path with heart -  a guide through the perils and promises of spiritual l- jack kornfield

a path with heart - a guide through the perils and promises of spiritual l- jack kornfield

... hours a day I was offered excellent teachings in great monasteries led by Mahasi Sayadaw, Asabha Sayadaw, and Achaan Buddhadasa I learned wonderful things in these periods of practice and am perennially ... can choose a path with heart Sometimes it takes a shock to awaken us, to connect us with our path Several years ago I was called to visit a man in a San Francisco hospital by his sister He was ... this path have a heart? If it does, the path is good If it doesn’t, it is of no use The teachings in this book are about finding such a path with heart, about undertaking a path that transforms and...

Ngày tải lên: 11/06/2014, 12:01

250 467 0
báo cáo hóa học: "Design of a complex virtual reality simulation to train finger motion for persons with hemiparesis: a proof of concept study" docx

báo cáo hóa học: "Design of a complex virtual reality simulation to train finger motion for persons with hemiparesis: a proof of concept study" docx

... rate at which task parameters change may affect the rate at which a particular subject learned to perform a task The algorithm experiment also suggests that the rate of task parameter change may ... performance is an intervention approach associated with skill acquisition and neuroplasticity [20-22] Adaptive algorithms that control robotic assistance or virtual task parameters are an extremely ... to participant performance Using Algorithm A, target fractionation starts at previous target level and decreases continuously until a key press occurs With Factual = actual fractionation and...

Ngày tải lên: 19/06/2014, 08:20

10 506 0
Báo cáo hóa học: " Minimum-length scheduling with rate control in wireless networks: a shortest path approach" docx

Báo cáo hóa học: " Minimum-length scheduling with rate control in wireless networks: a shortest path approach" docx

... commonly appearing variables in the paper to facilitate the reader The variables are listed in the order they appear in Table below Appendix 2: Finding a shortest path on a dag Shortest path problems ... channel state, G, the achievable rates are equal to the case of Scenario 1, i.e., when the kth transmitter is activated alone, its achievable rate is bits/sec and when both transmitters are activated ... 14 V Srivastava, M Motani, Cross-layer design: a survey and the road ahead IEEE Commun Mag 43(12) (2005) 15 M van Der Schaar, NS Shankar, Cross-layer wireless multimedia transmission: challenges,...

Ngày tải lên: 20/06/2014, 22:20

15 376 0
Báo cáo khoa học: "Choosing simplified mixed models for simulations when data have a complex hierarchical organization. An example with some basic properties in Sessile oak wood (Quercus petraea Liebl.)" ppsx

Báo cáo khoa học: "Choosing simplified mixed models for simulations when data have a complex hierarchical organization. An example with some basic properties in Sessile oak wood (Quercus petraea Liebl.)" ppsx

... colour, spiral grain, multiseriate wood rays) on both standard small-size samples and industrial-size boards Our data have a hierarchical organization Each level of the hierarchy could be a level ... climates: north of Alsace (sandstone hills and sandy-loamy soils in the plain), Plateau lorrain, Val de Loire, Basse-Normandie, Allier-Bourbonnais (Center of France) In each region, a large range ... modeling the variability of Sessile oak growth, morphology and wood quality, based on appropriate sampling plans and use of available statistical methods (mixed models) This programme associated the...

Ngày tải lên: 08/08/2014, 14:20

9 304 0
Báo cáo y học: "Acute Complex Type A Dissection associated with peripheral malperfusion syndrome treated with a staged approach guided by lactate levels" ppt

Báo cáo y học: "Acute Complex Type A Dissection associated with peripheral malperfusion syndrome treated with a staged approach guided by lactate levels" ppt

... vessels or coronary arteries and there was no pleural or pericardial effusion Arterial bloods gas analysis revealed a mild acidosis (pH 7.34 with a base excess of -5.7) and an elevated lactate level ... organ ischemia can be managed through revascularization grafts such as axillary- femoral bypass Endovascular stenting without entry closure for type A dissection has the risk of cardiac tamponade ... right axillary and bilateral common femoral approaches, a 150 mm covered stent graft (Medtronic, Santa Rosa, USA) was deployed into the thoracic aorta, distal to the left subclavian artery A further...

Ngày tải lên: 10/08/2014, 10:20

5 389 0
PerronBremermann envelopes and pluricomplex Green functions with poles lying in a complex hypersurface

PerronBremermann envelopes and pluricomplex Green functions with poles lying in a complex hypersurface

... Reg A, the regular locus of A After composing with a local biholomorphic 18 mapping, we may assume that f (z) = z1 on a small ball V Ω around z0 This implies that Φ1tj (z) gj (z) = ∀z ∈ V \ A, ... measures and boundary values of plurisubharmonic functions, Ark Mat 39 (2001), 181-200 Nguyen Quang Dieu Hanoi National University of Education, 136 Xuan Thuy street, Cau Giay, Hanoi, Vietnam Email: ... more effort we can check that that G all the conditions in Theorem 1.5 are also satisfied Acknowledgements This article has been written during a stay of the firstnamed authors at VIASM in the winter...

Ngày tải lên: 14/10/2015, 07:59

20 252 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

... patient reported localized pain and a slight homolateral submandibular lymphadenopathy, without functional limitations or fever No occlusal hindrance was caused by these supernumerary teeth Although ... dentes supernumerarii Ann Anat 2006;188:163-169 25 Batra P, Duggal R, Parkash H Non-syndromic multiple supernumerary teeth transmitted as an autosomal dominant trait J Oral Pathol Med 2005;34:621-625 ... investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission of the algic...

Ngày tải lên: 25/10/2012, 11:40

7 598 0
Natural botanical products have a long history in the world and are featured in using a complex

Natural botanical products have a long history in the world and are featured in using a complex

... intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation of antitumor ... Yasukawa K, Ikeya Y, Mitsuhashi H, Iwasaki M, Aburada M, Nakagawa S, Takeuchi M, Takido M Gomisin A inhibits tumor promotion by 12-O-tetradecanoylphorbol-13acetate in two-stage carcinogenesis in ... incubated with a rabbit anti-human von Willebrand factor (DAKO, Copenhagan, Denmark) with a dilution of 1:200 overnight at 4°C After washing with PBS (0.01 M, pH 7.4), sections were incubated with...

Ngày tải lên: 03/11/2012, 09:54

9 713 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

... implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable Gradable adjectives mean a large class ... connection with health such as a faint chance, a faint hope _ Predicative adjectives beginning with aThe following adjectives are used only predicatively like afloat, afraid, alight, alike, alone, ashamed, ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation:...

Ngày tải lên: 10/04/2013, 14:46

44 1,8K 9
Approaches to Establish a Modeling WWTP with a Case Study in Qinghe WWTP

Approaches to Establish a Modeling WWTP with a Case Study in Qinghe WWTP

... WWTPs have their own data management systems, such as SCADA (Supervisor, Control and Data Acquisition) and control system with the function to pick up the analysis data and control the automatic ... conductance etc., and water quality analysis apparatus such as NH4+-N, PO43—P and COD etc The instruments should be maintained regularly, cleaned on time and calibrated periodically, to guarantee ... important to achieve the entire functions of operation control and administration In some WWTPs, wastewater analytical apparatuses and data transferring equipments are collocated sufficiently with...

Ngày tải lên: 05/09/2013, 09:08

9 677 0
Modeling ammonia-nitrogen degradation in a polluted stream with biofilm technique

Modeling ammonia-nitrogen degradation in a polluted stream with biofilm technique

... was 120 meter (m), the water face width was 8.6m, and the water depth was 0.7~1.5m, the shape of streambed and bank was unanimous basically in total test stream because of clearing silt and bank ... organisms downstream And they are open They can attain oxygen across the boundary between water and air So flow situation of streams can be regarded as good oxygen and pushed-flow basically Transporting ... examining, total amount of bacteria, nitrobacteria counting, alga differentiating and counting, DO, velocity of flow, water level, temperature and pH MODELING AMMONIA-NITROGEN BIODEGRADATION Ammonia-nitrogen...

Ngày tải lên: 05/09/2013, 09:38

9 357 0
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

... [1] Saini J.S Use of artificial roughness for Enhancing Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; ... in a rectangular rib roughened passage” International Journal of Heat and mass transfer; 123: 675-681, 2001 [6] Lau S.C., McMillin R.D and Han J.C Turbulent Heat transfer and friction in a square ... rectangular duct Int Journal of Heat and Mass Transfer1999; 42: 1597-1615 [16] Karwa R, Experimental studies of augmented heat transfer and friction in asymmetrically heated rectangular ducts with...

Ngày tải lên: 05/09/2013, 16:10

12 831 0
Hydromagnetic convective flow past a vertical porous plate through a porous medium with suction and heat source

Hydromagnetic convective flow past a vertical porous plate through a porous medium with suction and heat source

... friction at the wall against Kp for different values of magnetic parameter M and heat source parameter S are entered in Tables and respectively From Table 1, we observe that a growing magnetic parameter ... unsteady flow past an accelerated vertical porous plate with suction Bull Malays Math Sci., Soc 2006, 29(1), 33-42 [17] Das S S., Satapathy A. , Das J K., Sahoo S K Numerical solution of unsteady ... Unsteady free convective MHD flow and mass transfer past a vertical porous plate with variable temperature Bull Cal Math Soc.2005, 97 (2), 137-146 [15] Ogulu A. , Prakash J Heat transfer to unsteady...

Ngày tải lên: 05/09/2013, 16:10

12 428 0
Performing a Bulk Insert with SQL Server

Performing a Bulk Insert with SQL Server

... Alfreds Futterkiste Maria Anders Sales Representative Obere Str 57 Berlin 12209 ... type="xsd:string" sql:datatype="nvarchar(30)" /> ... of a XML bulk load operation The example defines an optional error log file, where the default is an empty string meaning that no error log is created You can bulk load data into multiple parent-child...

Ngày tải lên: 20/10/2013, 12:15

5 395 0
w