and internal resistance of a cell

... TTCTTCAAGGGCTGGCTCCCT CTGATCTAGAGGTACCGGATCC ATCCTCACGAACAAGCAG GATCGCGATGCAGGCCTT GGACGACTACAGCGTCTTCAGTAGA TCCAAACAGTCAGTTTCTTAACCGT Ó FEBS 2003 cDNA cloning of abalone cellulase (Eur J Biochem 270) ... enzyme cDNA cloning Construction of the cDNA library and cloning of cellulase cDNA was achieved as follows: Total RNA was extracted from g of abalone hepatopancreas by the ganidinium thiocyanate-phenol ... Tokyo, Japan) and used as an abalone cDNA library cDNAs encoding abalone cellulase were amplified by PCR from the cDNA library with degenerated primers synthesized on the basis of partial amino-acid...

Ngày tải lên: 20/02/2014, 23:20

... degradation activity of P hilaris cellulase against crystalline cellulose, Avicel (Merck) was used under the same conditions as the CMCase assay Optimal pH for P hilaris cellulase activity against ... 5.9 and 7.7, respectively Enzymatic degradation of cellulose and its derivatives by P hilaris cellulase To investigate the ability of P hilaris cellulase to degrade cellulose and its derivatives, ... (G5) and cellohexaose (G6) Lanes 2–5, G2–G5 treated with P hilaris cellulase at 37 °C for h and cellopentaose were degraded to cellobiose and cellotriose (Fig 2B) Production of cellobiose and cellotriose...

Ngày tải lên: 17/03/2014, 10:20

... Hausa language and ease of understanding of all the items The final version of the Hausa translation of IKHOAM (see Additional file 2) The anchors (English) on the visual analogue scale were also ... interpretation of data and drafting of the manuscript Both authors participated in the design of the study, read and approved the final manuscript 10 11 Additional material Additional file Ibadan Knee/Hip ... Cultural Adaptation and Validation of Singapore English and Chinese Versions of the Lequesne Algofunctional Index of Knee in Asians with Knee Osteoarthritis in Singapore Osteoarthritis and Cartilage...

Ngày tải lên: 18/06/2014, 19:20

... preparations and a WHO anti-HAV standard These three IG preparations contained similar levels of anti-HAV antibodies and had comparable neutralization potencies Our data showed that the ARTA is a ... reactive for anti-HAV antibodies Samples were analyzed in duplicates, and the means and standard deviations of the OD from each dilution were calculated and plotted Neutralization assay Neutralization ... screening of antivirals, and the evaluation of anti-HAV antibodies in IG preparations for human use Methods Cells and viruses Huh7 -A- I cells, a clone of human hepatoma Huh7 cells that support the stable...

Ngày tải lên: 12/08/2014, 04:21

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3¢ Cell survival and apoptosis analysis In vivo interaction ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and...

Ngày tải lên: 07/03/2014, 21:20

... Oobatake M & Kanaya S (1995) Characterization of the internal motions of Escherichia coli ribonuclease HI by a combination of 15N-NMR relaxation analysis and molecular dynamics simulation: examination ... requires structure and dynamic characterization in solution of the various functionally relevant states To achieve this aim, we initiated a structural and dynamics analysis of Ca2+-saturated NSCP in ... changes signicantly upon Ca2+ binding [14], from an almost antiparallel conguration to a perpendicular arrangement In a domain containing a pair of EF-hand motifs, this movement creates a large...

Ngày tải lên: 23/03/2014, 13:20

... and analysed the data and wrote the first draft AI and CR contributed to the study design and the analysis AM contributed to the analysis and wrote the final manuscript All authors read and approved ... translation and validation study of the Iranian version Health Qual Life Outcomes 2003, 1:66 Campbell A, Knowles S: A confirmatory factor analysis of the GHQ12 using a large Australian sample ... French and to examine its psychometric properties and factor structure (i.e one, two or three factors) in a sample of elderly French adults Translation and data collection The standard "forward-backward"...

Ngày tải lên: 18/06/2014, 19:20

... basis of Equation for a random Gaussian force that was band-limited to 200 Hz and had a standard deviation of σs = pN (b) Sensitivity as a function of the amplitude of the sinusoidal external ... sensitivity of the stochastic model as a function of frequency This was done using Equation and a Gaussian external force that was band-limited to 200 Hz and had a standard deviation of pN For each choice ... maximum permeability of IDRK ; [K]in = 112 mM and [K]ex = mM are intracellular and extracellular K+ concentration; F and R are Faraday and universal gas constants; T = 295.15 K is the temperature...

Ngày tải lên: 20/06/2014, 23:20

... sectorization and BS antenna radiation pattern has also been studied Cells sectorization and use of narrow beam BS antennas increase Konstantinos B Baltzis significantly the capacity of a cellular system ... numerical evaluation of the proposed model are presented The accuracy of the proposed model and the circular -cell approximation is examined in detail The impact of the BS antenna radiation pattern and ... Chapman & Hall/CRC, Boca Raton, Fla, USA, 2nd edition, 2002 [17] L E Br˚ ten, M Pettersen, and A Spilling, “An evaluation a of adaptive arrays for a UMTS FDD network deployed in a suburban area...

Ngày tải lên: 21/06/2014, 23:20

... http://www.jeccr.com/content/30/1/55 Page of Figure Effect of miR-2 7a on ADR intracellular accumulation and releasing of MKN45 cells A, Fluorescence intensity analysis of intracellular ADR in cells; B, ADR releasing index of cells ... results of MTT assay and soft agar assay revealed that down-regulation of miR-2 7a inhibited cell growth of gastric cancer cells in vitro, which was consistent with the data of nude mice assay The ... accumulation and decreased releasing index of ADR of miR-2 7a antagomir cells was observed as compared with control cells (p < 0.05) Effect of mir-2 7a on protein regulating proliferation and drug resistance...

Ngày tải lên: 10/08/2014, 10:21

... specificity of action [10] Adenovirus VA RNAI and VA RNAII are cleaved by Dicer and act as RNAi suppressors [13] Both Tat protein and VA RNAs inhibit Dicer activity A striking feature of RNAi suppressors ... translation and replication and as a consequence becomes unavailable to bind Dicer and mediate RNAi In this case, both TRBP and Tat would participate in the inhibition of HIV restriction by RNAi ... KL, Garcia-Sastre A, Ball LA, Palese P, Ding SW: Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing Proc Natl Acad Sci USA 2004, 101:1350-1355 Andersson...

Ngày tải lên: 13/08/2014, 09:21

... subset was quantified using a standardized assay as described in Materials and methods, and is given as HLA-DR antibodies per cell (Ab /cell) (b) For plasmacytoid dendritic cells (PDCs) and myeloid ... HP, JCS, and CM were responsible for data management and statistical analysis HP, JCS and CM wrote the manuscript HZ-B was responsible for patient recruitment and management, and participated together ... laboratory Statistical analysis For statistical analyses, SPSS for Windows software (version 12.0; SPSS, Inc., Chicago, IL, USA) was used Data are presented as the mean ± standard deviation The Mann –...

Ngày tải lên: 13/08/2014, 18:22

... CATGTTCGGTTGGTCAAAGA CCCAAGAGATCCCCCACAT GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ... CGCGTCATCTGTAAGTGGTTCAACGTTTCAAGAGAACGTTGAACCAC TTACAGATGTTTTTCATATGAT 3’ LIN28sh2R 5’ CGATCATATGAAAAACATCTGTAAGTGGTTCAACGTTCTCTTGAAAC GTTGAACCACTTACAGATGA 3’ Page 24 NM_024674.4 2.4 Transfection and ... TGGGCATCAGGCCAAGTC TGCAGGTCCCTTGGACATG TGGCGCCGGTTACAGAAC AAGCTGTATATTTACTCATTGAAA CAC GCCATCATCATTACCCATTGC GCCCAATACGACCAAATCC ACCCGTGGTCACCATGGTA Chapter Results 3.1 SAGE data analysis to search...

Ngày tải lên: 16/10/2015, 11:58

...  between  local and  extra-­‐local   influences  is  an  arguably  precarious  regime of  capital  accumulation  that,  albeit  in   a  state of  momentary  stability,    “is  not  static and  fixed ...  preponderance of  poverty  in  many   countries,  especially  those  in  Asia and  Africa  Whilst  many  supranational   organizations,  for  example  the  International  Labour  Organisation and ...  political   geography of  labour  organising  Space and  spatiality  has  been a  crucial  issue  in   the  politics of  organized  labour,  tracing  back  to  the  foundations of  American...

Ngày tải lên: 16/10/2015, 12:00

... percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel Biodiesel of karanjia has a lower percentage of unsaturation and has a higher value of maximum heat ... and exhaust gas temperature was observed in case of high unsaturated biodiesel Heat release rate and cumulative heat release rate is lower in case of high- unsaturated biodiesel fuel A general ... properties and combustion parameters "X" variable % of Unsaturation Density Cetane number Heating value Iodine value "Y" variable Start of dynamic injection bTDC Ignition delay Maximum heat release rate...

Ngày tải lên: 05/09/2013, 15:28

... Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen states of India have reserve a total of 1.72 million ... using heated distilled water was carried out to remove some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing ... Vitoloi S Brassica Carinata as an alternative oil crop for the production of biodiesel in Italy: engine performance and regulated and unregulated exhaust emissions Environmental Science and Technology...

Ngày tải lên: 05/09/2013, 16:11

... southern Asia, and it is a staple food for a large part of the world’s human population especially in east, south and south-east Asia, making it the most consumed cereal grain Rice bran oil is extracted ... 349 Deepak Agarwal, Avinash Kumar Agarwal, Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine, Applied Thermal Engineering ... Nagarajan.G, Mahua (Madhuca indica) seed oil: A source of renewable energy in India, Journal of Scientific and Industrial Research 64, (November 2005): 890 – 896 R Raghu has completed master of...

Ngày tải lên: 05/09/2013, 16:11

... higher than for the MERS case The influence of actual switch characteristics and thermal capability has been investigated An average peak junction temperature of 125°C and 80°C heat sink temperature ... Ryuichi Shimada, Jan A Wiik, Takanori Isobe, Taku Takaku, Noriyuki Iwamuro, Yoshiyuki Uchida, Marta Molinas, and Tore M Undeland A new ac current switch called mers with low on-state voltage igbts ... generator voltage and the maximum output power can be increased A configuration using a variable series compensation device called a magnetic energy recovery switch (MERS) and a diode bridge has...

Ngày tải lên: 15/10/2013, 16:11

Ngày tải lên: 17/10/2013, 10:11

... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... on a coordinate transformation and an input transformation as well But the main advantage of the Park transformation is to define an internal state variable which is physically meaningful : that ... The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an...

Ngày tải lên: 03/01/2014, 19:44