and a long range interaction

Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

... is endocytosed via a clathrin- and caveolinindependent pathway, whereas BPV1 and HPV31 were shown to enter via clathrincoated pits and caveolae, respectively Additional details are provided in ... 8784–8792 Kawana Y, Kawana K, Yoshikawa H, Taketani Y, Yoshiike K & Kanda T (2001) Human papillomavirus type 16 minor capsid protein L2 N-terminal region containing a common neutralization epitope ... HSPGs contain unbranched oligosaccharides composed of alternating disaccharide units of uronic acid and glucosamine, which are sulfated and acetylated to various degrees O-sulfation occurs at the...

Ngày tải lên: 23/03/2014, 04:20

11 511 0
Báo cáo y học: "Synorth: exploring the evolution of synteny and long-range regulatory interactions in vertebrate genomes." potx

Báo cáo y học: "Synorth: exploring the evolution of synteny and long-range regulatory interactions in vertebrate genomes." potx

... from the far East Nat Rev Genet 2002, 3:53-64 Kasahara M, Naruse K, Sasaki S, Nakatani Y, Qu W, Ahsan B, Yamada T, Nagayasu Y, Doi K, Kasai Y, Jindo T, Kobayashi D, Shimada A, Toyoda A, Kuroki ... Fujiyama A, Sasaki T, Shimizu A, Asakawa S, Shimizu N, Hashimoto S, Yang J, Lee Y, Matsushima K, Sugano S, Sakaizumi M, Narita T, Ohishi K, Haga S, Ohta F, et al.: The medaka draft genome and ... orthologs Nucleic Acids Res 2005, 33:D476-480 Matsuya A, Sakate R, Kawahara Y, Koyanagi KO, Sato Y, Fujii Y, Yamasaki C, Habara T, Nakaoka H, Todokoro F, Yamaguchi K, Endo T, Oota S, Makalowski W, Ikeo...

Ngày tải lên: 09/08/2014, 20:20

14 399 0
AP 2 regulates estrogen receptor mediated long range chromatin interactions and gene transcription

AP 2 regulates estrogen receptor mediated long range chromatin interactions and gene transcription

... Gustafsson, 2001; Schwabe et al, 1993) D domain contains the nuclear localization signal (NLS) and also acts as a hinge between the C and E/F domain Apart from ligand binding and transcriptional ... Schematic diagram of ER functional domains and their homology ERα and ERβ are homologous proteins that are structurally characterized by six functional domains AF-1 and AF-2 within the A/ B and ... progression and establishment of distant metastases (Penna et al, 2011) On contrary, nuclear level of AP-2γ is elevated in testicular carcinoma in situ and advanced stage of ovarian cancer (Hoei-Hansen...

Ngày tải lên: 09/09/2015, 10:20

178 273 0
Natural botanical products have a long history in the world and are featured in using a complex

Natural botanical products have a long history in the world and are featured in using a complex

... intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation of antitumor ... days Tumor areas were measured every days using a caliper, and the tumor area was calculated according to the formula: tumor volume (mm3) = d2 x D/2, where d and D were the shortest and the longest ... biological parameters in tumorigenesis including cell proliferation and apoptosis [7], and also angiogenesis [8] were assessed in gastric tumors after drug treatment Materials and methods Chemicals and...

Ngày tải lên: 03/11/2012, 09:54

9 713 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

... from clones isolated previously [22] using the following primers: gatggatcccatATGGGTG TTGAAGTTGTA annealing around the start codon of the Ppi1 ORF and gactcgagATTAGTCGACTTCTTACGC annealing just before ... reaction was carried out for 60 at 30 °C Released Pi was determined as described 5869 Interaction between plasma membrane H+-ATPase and PPI1 in De Michelis and Spanswick [33] The PM H+-ATPase activity ... Michelis MI (2002) A novel interaction partner for the C-terminus of Arabidopsis thaliana plasma membrane H+-ATPase (AHA1 isoform): site and mechanism of action on H+-ATPase activity differ from those...

Ngày tải lên: 19/02/2014, 07:20

8 629 0
Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf

Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf

... Gyurkovics an NIH grant as a subcontractor and by the Hungarian National Granting Agency, OTKA L S is supported by an NIH FIRCA grant References ´ Casanova J, Sanchez-Herrero E & Morata G (1986) ... independent interactions Trans Genet 139, 815–833 18 Hendrickson JE & Sakonju S (1995) Cis and trans interactions between the iab regulatory regions and abdominal -A and Abdominal-B Drosophila melanogaster ... contain a boundary and at least one PRE, and are able to mediate long- distance regulatory interactions via the association between homologous regions In transgenic lines, these sequences can interact...

Ngày tải lên: 20/02/2014, 01:20

7 719 0
Báo cáo khoa học: Interactions between metals and a-synuclein ) function or artefact? pptx

Báo cáo khoa học: Interactions between metals and a-synuclein ) function or artefact? pptx

... to cause disease These mutations are associate with early onset of the disease and has the pathology includes LBs and is autosomal dominant [21] a- synuclein a- synuclein is a small (14 kDa), highly ... to the parkinsonian neurotoxin MPTP Proc Natl Acad Sci USA 99, 14524–14529 43 Chandra S, Fornai F, Kwon HB, Yazdani U, Atasoy D, Liu X, Hammer RE, Battaglia G, German DC, Castillo PE et al (2004) ... oxidation and nitration can also increase the rate of conversion [76] Binding of polyanions to the C-terminal domain can also catalyse protein aggregation [58] Current research has suggested that...

Ngày tải lên: 07/03/2014, 10:20

9 467 0
Báo cáo khoa học: Intrinsic local disorder and a network of charge–charge interactions are key to actinoporin membrane disruption and cytotoxicity ppt

Báo cáo khoa học: Intrinsic local disorder and a network of charge–charge interactions are key to actinoporin membrane disruption and cytotoxicity ppt

... composed by b-strands 145–150 and 156–161 and they are rich in hydrophobic and exposed residues In particular, the aromatic rings of Y140 and W146 have high accessible surface area (30% and 35%, respectively) ... interactions are effective at long range In addition, the loss of interactions due to the R29Q substitution endows Fig Backbone heteronuclear R1 and R2 relaxation rates and NMR NOE relaxation data for ... StnII mutants Table NMR structural calculations summary and statistics StnII-R29Q Calculation Distance restraints Angular restraints ˚ Max violation (A) (20 structures) Energy function (mean value)...

Ngày tải lên: 14/03/2014, 23:20

10 376 0
Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

... tryptophanyl radical in all the lysozymes studied appears to be an intramolecular process The monomolecular rate constants at pH 7.0 and 25 °C are summarized in Table In the seconds time range there ... range there is a final slow radical decay This reaction was always secondorder representing a radical–radical recombination reaction (e.g dimerization of TyrOÆ radical) Thus, the reaction (2) equilibrium ... both tryptophan and tyrosine; i.e absorbance maxima at % 510 and 410 nm, and isosbestic points at % 430 nm and % 370 nm [7,8] These isosbestic points, together with the fact that the apparent first-order...

Ngày tải lên: 17/03/2014, 10:20

7 475 0
Báo cáo khoa học: Structures and mode of membrane interaction of a short a helical lytic peptide and its diastereomer determined by NMR, FTIR, and fluorescence spectroscopy pdf

Báo cáo khoa học: Structures and mode of membrane interaction of a short a helical lytic peptide and its diastereomer determined by NMR, FTIR, and fluorescence spectroscopy pdf

... not a prerequisite for maintaining an interface localization of a peptide In summary, the structural and functional analyses of the all-L-amino acids peptide and its diastereomeric analog indicate ... spectra to a log-normal distribution Nonlinear least-squares (NLLSQ) analyses and data simulations were performed with ORIGIN 6.1 software package (Microcal, Inc., Northampton, MA, USA) Tryptophan ... initial parameters; (b) all the peaks had reasonable half-widths ( 20–25 cm)1); and < (c) good agreement was achieved between the calculated sum of all components and the experimental spectra were...

Ngày tải lên: 17/03/2014, 11:20

12 409 0
Báo cáo Y học: Molecular interactions between nuclear factor kB (NF-kB) transcription factors and a PNA– DNA chimera mimicking NF-kB binding sites doc

Báo cáo Y học: Molecular interactions between nuclear factor kB (NF-kB) transcription factors and a PNA– DNA chimera mimicking NF-kB binding sites doc

... AACAGAAAGTGATAACTCT-3 (sense strand, GATA-1) and 50 -CATGTTATGCATATTCCTGTAAGTG-30 (sense strand, STAT-1) Stability of decoy molecules The stability of decoy molecules was evaluated after incubation ... prepared according to Dignam et al [40] The nucleotide sequences of competitor double stranded target DNAs used as controls were 50 TAATATGT AAAAACATT-30 (sense strand, NF-IL 2A) , 50 CACTTGAT AACAGAAAGTGATAACTCT-3 ... DNA and PNA –DNA– PNA based decoys with 30 !50 exonuclease III, 50 !30 lambda exonuclease and DNase I ExoIII and lambda exonuclease were purchased from MBI Fermentas and DNase I from Promega...

Ngày tải lên: 24/03/2014, 04:21

10 380 0
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx

... Survival and Maternal Health account in fiscal years 2004 and 2005 helped fund wide-ranging efforts to lower maternal and child mortality in Africa, Asia and the Near East, and Latin America and ... management and reporting system; the Bureau of Policy and Program Coordination; the Bureau for Global Health; and the regional bureaus for Africa, Asia and the Near East, and Latin America and the Caribbean ... countries in Africa, Asia and the Near East, and Latin America and the Caribbean and to the Bureau for Global Health In allocating the funds, the agency considered various factors in its annual budgeting...

Ngày tải lên: 28/03/2014, 09:20

64 380 0
Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx

Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx

... obtained from TOYOBO (Osaka, Japan) and New England Biolabs Japan (Tokyo, Japan) Protein markers were obtained from Fermentas Life Sciences (Ontario, Canada) and Oriental Yeast (Tokyo, Japan) Antibodies ... COQ1 -a COQ1-b dps1 -a dps1-b Description (5¢- to 3¢) CCGGATCCCATGTTTCAAAGGTCTGGC GCCCCCGGGTTACTTTCTTCTTGTTAGTA TAC CCGGATCCATGTTTCAAAGGTCTGGC CGAATTCTTACTTTCTTCTTGT CAGTGAATTCGAGCTCGGTACCC ATACATACTGAATCATCATCTCCTTC ... functional expression in Escherichia coli and Saccharomyces cerevisiae J Bacteriol 179, 5992–5998 20 Okada K, Kainou T, Tanaka K, Nakagawa T, Matsuda H & Kawamukai M (1998) Molecular cloning and mutational...

Ngày tải lên: 30/03/2014, 04:20

16 315 0
global and national macroeconometric modelling a long-run structural approach oct 2006

global and national macroeconometric modelling a long-run structural approach oct 2006

... Statistical Association (Chapters and 11) and Journal of Econometrics (Chapter 6) And the project has also been assisted greatly by the contributions of Yoga Affandi, Mutita Akusuwan, Mahid Barakchian, ... incorporate features such as adjustment costs (e.g Kydland and Prescott, 1982, Christiano and Eichenbaum, 199 2a, and Cogley and Nason, 1995); signal extraction and learning (e.g Kydland and Prescott, ... invaluable comments from Manuel Arrelano, Michael Binder, Carlo Favero, Paul Fisher, Clive Granger, David Hendry, Cheng Hsiao, George Kapetanios, Adrian Pagan, Bahram Pesaran, Til Schuermann, James...

Ngày tải lên: 11/06/2014, 05:36

397 451 0
báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" pdf

báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" pdf

... Assessment-On arrival to the hospital a detailed history was elicited and associated injuries were documented Standardised Anteroposterior and lateral radiographs were taken and after thorough evaluation, ... Postoperative Radiograph (Anteroposterior and Lateral view) Figure 10 Case Radiograph at year followup Anteroposetrior and Lateral view Page of 10 Raju and Kini Journal of Orthopaedic Surgery and Research ... original palmar tilt could not be achieved in all cases despite maintaining radial length and radial The restoration of palmar tilt requires multiplanar ligamentotaxis or a pin in the dorsal fragment...

Ngày tải lên: 20/06/2014, 04:20

10 427 0
báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" potx

báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" potx

... Assessment-On arrival to the hospital a detailed history was elicited and associated injuries were documented Standardised Anteroposterior and lateral radiographs were taken and after thorough evaluation, ... Postoperative Radiograph (Anteroposterior and Lateral view) Figure 10 Case Radiograph at year followup Anteroposetrior and Lateral view Page of 10 Raju and Kini Journal of Orthopaedic Surgery and Research ... original palmar tilt could not be achieved in all cases despite maintaining radial length and radial The restoration of palmar tilt requires multiplanar ligamentotaxis or a pin in the dorsal fragment...

Ngày tải lên: 20/06/2014, 07:20

10 335 0
Báo cáo hóa học: " Research Article Development of Long-Range and High-Speed Wireless LAN for the Transmission of Telemedicine from Disaster Areas" pdf

Báo cáo hóa học: " Research Article Development of Long-Range and High-Speed Wireless LAN for the Transmission of Telemedicine from Disaster Areas" pdf

... is that VSAT equipment is heavy When a large-scale natural disaster occurs, it may be impossible to take VSAT equipment to some devastated areas, since roads are greatly damaged and all traffic ... This earthquake drill was planed on the supposition that a strong and large-scale earthquake occurred in a mountainous area and all possible communication networks to this area become unavailable ... unit and a telephone set The difference is that the video transmitter has a special antenna with a shape of a gun, and that a cable connecting between the antenna and the case, a wireless LAN unit...

Ngày tải lên: 22/06/2014, 06:20

13 319 0
Báo cáo sinh học: " Liaison amid disorder: non-native interactions may underpin long-range coupling in proteins" ppsx

Báo cáo sinh học: " Liaison amid disorder: non-native interactions may underpin long-range coupling in proteins" ppsx

... thus a parameter for native specificity As the strength of favorable non-native interactions decreases with increasing s, the associated long- range coupling diminishes Could all non-native interactions ... native interactions) Native specificity is the ability of a set of interactions to discriminate against non-native attractions and is indicated here by the parameter s Hydrophobic (H) and polar (P) ... predictions about long- range coupling obtained by Noivirt-Brik et al [1] and from the HP model are robust Folding cooperativity may dampen but cannot eliminate non-native interactions Contact interactions...

Ngày tải lên: 06/08/2014, 18:21

5 171 0
Báo cáo y học: " Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions" pps

Báo cáo y học: " Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions" pps

... Nosema ceranae 100 Nosema ceranae 100 Encephalitozoon cuniculi Antonospora locustae 99 100 97 100 Paranosema grylli ATP transporters Clade I Antonospora locustae Antonospora locustae Ancestral ATP ... microsporidia and their ATP transporters (a) Phylogenetic reconstruction of the microsporidian phylogeny based on available - and -tubulin amino acid sequences and gains of ATP and ABC transporters ... of evolutionary ecology into the post-genomic era Materials and methods DNA and RNA extraction and DNA sequencing Total RNA and genomic DNA from O bayeri (isolate OER 33 from the Island Oeren in...

Ngày tải lên: 09/08/2014, 20:20

12 400 0
Báo cáo y học: "A long-term follow-up of a girl with dilated cardiomyopathy after mitral valve replacement and septal anterior ventricular exclusion" docx

Báo cáo y học: "A long-term follow-up of a girl with dilated cardiomyopathy after mitral valve replacement and septal anterior ventricular exclusion" docx

... functional class, who not respond to medical therapy, are candidates for heart transplantation In addition to the shortage of available organs, there are legal, economical, ethical and technical problems ... uptake was decreased from the anterior part of the IVS and anterior wall of the LV on cardiac scintigraphy (Arrow: Anterior wall of LV, Arrowhead: Anterior part of IVS) Randas Batista et al described ... Bakris GL, Cohen JD, Parmley WW: A calcium antagonist vs a non-calcium antagonist hypertension treatment strategy for patients with coronary artery disease The International Verapamil-Trandolapril...

Ngày tải lên: 10/08/2014, 10:20

3 359 0
w