... understanding of the anatomy and function of the ear and the auditory nervous system, and it discusses the cause and treatment of hearing disorders Most books on hearing focus either on the anatomy ... original work on the different subjects Understanding of the anatomy and the function of the auditory system together with knowledge about the pathophysiology of the auditory system are essential ... function of the cochlea than of any other sensory organ C H A P T E R Anatomy of the Ear ABSTRACT 10 The ear consists of the outer ear, the middle ear and the inner ear The outer ear consists of the...
Ngày tải lên: 11/08/2014, 06:21
... at the entrance of the ear canal compared with the sound pressure that is measured in the place of the head The effect of the head on the sound at the entrance of the ear canal is related to the ... ratio between the effective area of the tympanic membrane and the area of the stapes footplate, but the lever ratio of the middle ear bones also contributes The ratio of areas of the BOX 2.2 SOUND ... remarkable in the light of the FIGURE 2.12 (A) Average displacements of the umbo, the head of the stapes and the lenticular process of the incus (B) The lever ratio at 124 dB SPL at the tympanic...
Ngày tải lên: 11/08/2014, 06:21
ANATOMY, PHYSIOLOGY, AND DISORDERS OF THE AUDITORY SYSTEM - PART 4 potx
... anatomy and physiology of the auditory nervous system of clinical importance Most studies of the function of the auditory system have aimed at the coding of different kinds of sounds in the auditory ... in the ventral parts of the MGB of the thalamus, the nonclassical sensory pathways use the dorsal and medial division of the MGB as relay (Fig 5.10) [122] These divisions of the MGB receive their ... of the fourth ventricle (Fig 5.15B) [72] The other part of the olivocochlear system projects mainly to the contralateral cochlea and the fibers of that system travel deeper in the brainstem The...
Ngày tải lên: 11/08/2014, 06:21
ANATOMY, PHYSIOLOGY, AND DISORDERS OF THE AUDITORY SYSTEM - PART 6 pot
... The caudal portion of the floor of the lateral recess is the (dorsal) surface of the dorsal cochlear nucleus and the rostral portion of the floor of the lateral recess is the dorsal surface of ... difference between the latency of the N1 of the AP and that of the response from the intracranial portion of the auditory nerve is the travel time in the auditory nerve from the ear to the recording ... the latency of the first peak in the dipole and the length is the relative strength of the dipoles Note the short distance between the two first dipoles (peak I and II of the ABR) and the third...
Ngày tải lên: 11/08/2014, 06:21
ANATOMY, PHYSIOLOGY, AND DISORDERS OF THE AUDITORY SYSTEM - PART 7 pot
... and standard error of the mean are shown as a function of the intensity of the noise The TTS was measured 20 s after the end of the exposure In this study the noise exposure consisted of a band ... basis of the elevation of the hearing threshold in disorders of the middle ear and the cochlea but the effect on the function of the nervous system may affect speech discrimination Impairment of speech ... decreases the input to the cochlea and thereby decreases the contraction of the stapedius muscle, and that in turn causes the input to the cochlea to again increase, and that increases the contraction...
Ngày tải lên: 11/08/2014, 06:21
ANATOMY, PHYSIOLOGY, AND DISORDERS OF THE AUDITORY SYSTEM - PART 8 docx
... increase the sensitivity and frequency selectivity of the ear (cf Chapter 3) The widening of the tuning of the basilar membrane broadens the “slices” of the spectrum of broad band sounds from which the ... noninvasively The outcome of the test depends on fine details of the anatomy of the stapes and its suspension in the oval window, the incudo-stapedial joint and the orientation of its plane surface ... this view of flexibility of the function of the auditory system That injury and loss of cochlear hair cells can cause profound changes in the structure and function of the central auditory system...
Ngày tải lên: 11/08/2014, 06:21
ANATOMY, PHYSIOLOGY, AND DISORDERS OF THE AUDITORY SYSTEM - PART 9 pdf
... tinnitus and abnormal perception of sounds such as hyperacusis and phonophobia) are some of the most diverse and complex disorders of the auditory system and their causes are often obscure Often ... corresponding to the F1 frequency and the other corresponding to the frequency of F2 The rate of the impulses is that of F0 for voiced sounds, and a quasi-random rate (average of 100 pps) for ... determined on the basis of the output of 16 band-pass filters The output of the six band-pass filters with the largest amplitudes is coded in the impulses that are applied to the electrodes in the cochlea...
Ngày tải lên: 11/08/2014, 06:21
Tài liệu Báo cáo khoa học: SREBPs: physiology and pathophysiology of the SREBP family ppt
... H Shimano Physiology and pathophysiology of the SREBP family SREBP-1c and lipogenesis The SREBP family consists of three isoforms: SREBP1a, SREBP-1c, and SREBP-2 Each isoform has a different ... Physiology and pathophysiology of the SREBP family H Shimano at G1 [19] In particular, p21 is a direct target of SREBP [20] The role of SREBP-1a in the regulation of cell growth and the cell cycle ... adipogenesis and obesity associated with insulin resistance [48] The exact roles of SREBP-1c ⁄ ADD1 are not yet fully defined SREBP and parasympathetic function in heart Parasympathetic stimulation of the...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: "REVERSIBLE AUTOMATA AND INDUCTION OF THE ENGLISH AUXILIARY SYSTEM" doc
... out of 44 variants and the passive system from 14 out of 22 The entire active system is learnable once examples of each form of each verb and each modal have been seen, plus one example to fix the ... force the separate tre.atment of active versus passive forms Then if, say on considerations of frequency of occurrence, exceptions were externally handled and the infrequent The auxiliary system ... inferential power and the proper handling of exceptions For l-reversible inference, 45 of the verb sequences of length three or shorter will yield the remaining nine such strings and nonc longer...
Ngày tải lên: 24/03/2014, 01:21
THE BIOLOGY, PHYSIOLOGY AND SOCIOLOGY OF REPRODUCTION ALSO SEXUAL HYGIENE WITH SPECIAL REFERENCE TO THE MALE docx
... the company of his young lady friend—through the pressure of her hand upon his arm, the lithe, graceful movement of body and limbs, the smile, the light in the eye and the soft voice All of these ... Summary of Principles 24 a The propagation of offspring and the protection and support of the young and defenseless, always involve sacrifice on the part 24 of the parents and the stronger members of ... movements and partly by the action of the cilia in the ducts of the epididymis and the peristaltic contractions of the vas deferens—hurried along the vas to the ampulla If the period of sexual...
Ngày tải lên: 06/03/2014, 13:20
An overlooked connection: serotonergic mediation of estrogen-related physiology and pathology potx
... of the other pathologies as well as contributed to the writing of the rest of the manuscript SMM provided cross species analysis and contributed to the writing of the manuscript RMG wrote and ... alteration of a normal cell; promotion involves both proliferation of initiated cells and suppression of apoptosis of these cells; and progression is the irreversible conversion of one of the promoted ... verifying the effects of E2 in all systems and integrating the contents of the paper provided by other coauthors DRP wrote and provided content in relation to breast cancer and epidemiologic review of...
Ngày tải lên: 28/03/2014, 14:20
ADVANCES IN THE ETIOLOGY, PATHOGENESIS AND PATHOLOGY OF VASCULITIS potx
... control of the vascular inflammation and disruption of endothelium, allowing the passage of the virus in the organs The early NiV infection of endothelial cells importantly upregulated the chemokines ... allow the second cycle of replication of the virus and the viremia NiV infection is characterized by the formation of syncytia leading to the endothelial damages, which are thought to be the cause ... GTCCACCACCCTGTTGCTGTAG The relative expression represents the ratio of the number of copy of mRNA of interest versus mRNA of GAPDH All calculations were done using the 2CT model of (Pfaffl, 2001) and experiments...
Ngày tải lên: 27/06/2014, 19:20
Pathology of the Head and Neck docx
... experts in the field of the pathology of the head and neck As such they are the main members of the Working Group on Pathology of the Head and Neck of the European Society of Pathology, one of the first ... description of the manifold aspects of the morphology and pathology of the organs of the head and neck region These description, as comprehensive as they may be, also show that there are some areas of the ... Head and Neck” is that the proximity of the organs of the head and neck region makes it difficult for the surgical pathologist to focus on one of these organs and neglect the pathology of others,...
Ngày tải lên: 29/06/2014, 09:20
báo cáo khoa học: "Adenoid cystic carcinoma intermingled with ductal carcinoma of the breast: a case report and review of the literature" docx
... present Both the nuclear grade of the lesion and the Bloom-Richardson grade were two based on the overall appearance of the tumor The lymph nodes were negative The tumor was staged as T1N0M0 and was ... tumors Chemotherapy seems to have a significant role in the treatment of mixed ACC of the breast, not only due to the lack of hormone receptors but also because of the aggressiveness of the non-ACC ... the histological examination of the specimen and contributed to the writing of the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"
... case of MZ with mirror-imaging of AC in the literature In this case, we describe the second case of MZ with mirror-imaging of AC and discuss the possible clinical implications First, Helland and ... lack of systematic monitoring and follow-up Therefore, a large percentage of patients with AC are probably undiscovered Mirror images, on the other hand, are present in approximately 25% of MZ Therefore, ... consider that it is mandatory to monitor the counterpart of the symptomatic patient with AC as early as possible, irrespective of the absence of symptoms Conflict of Interest The authors have declared...
Ngày tải lên: 25/10/2012, 11:00
Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"
... craniotomy because of the proximity of the sinus to the orbit and the anterior skull base [5] The frequency of bilateral absence of the frontal sinus has been reported in 3-4% to 10% of several populations ... reliability between observers and was 0.86 Fig Unilateral absence of the frontal sinus; on the right, the absence of the frontal sinus, and on the left, the limited aeration of the frontal sinus; axial ... sinuses, although there is only one frontal sinus ostium The size of the sinus and, therefore, its anatomic relationships also depend upon the extent of pneumatization [11] The extent of pneumatization...
Ngày tải lên: 25/10/2012, 11:04
Báo cáo y học: " Post-traumatic glioma: Report of one case and review of the literature"
... occurrence of the tumor corresponded exactly one to the other; and (4) there was a more than one year interval between trauma and the appearance of the tumor As regards the pathogenesis of post-traumatic ... time interval between trauma and the appearance of the tumor of at least year, a longer latent period increasing the likelihood of a causal relationship The presence of the tumor must be proved histologically ... at the time of the trauma demonstrating significant injury and the follow-up scans demonstrating tumor at the same site4 With the routine use of CT and magnetic resonance imaging (MRI), some of...
Ngày tải lên: 25/10/2012, 11:48
. Scope and Limitations of the Study
... circumstances In the resolutions of the VIth and the VIIth congresses of the Communists Party and those of the important meeting of the National Assembly, the Government and the Central Party ... building up the whole system It is hoped that these schools (10-15% of the sector) will reach the standards of the best institutions in the region and gradually those of the world While these school ... assessment the demand of skilled labor and how to solve the gap between demand and supply of skilled labor for sustainable economic growth in Vietnam Objectives of the Study The objectives of the study...
Ngày tải lên: 13/04/2013, 10:31
Scope and Limitations of the Study
... component of most management definitions of strategy Strategy is the determination of the basic long-term goals and objectives of an enterprises, and the adoption of courses of action and the allocation ... features 60 As a rule, then, the lower the price of substitutes, the higher the quality and the performance, and the lower the user’s switching costs, the more intense are the competitive pressures ... market conditions in the supplier industry and the significance of the item they supply The competitive fore of suppliers is greatly diminished whenever the item they provide is a standard commodity...
Ngày tải lên: 13/04/2013, 10:32