anatomical for the general gynaecologist and gynaecologist in training

... phosphine is a quick and effective tool for the control of stored-product insect pests In view of the scheduled phaseout of methyl bromide under the Montreal protocol, the role of phosphine in grain ... (=20 g m−3 ) and exposure time of day were not effective in killing the insects at the bottom of the column when the fumigant was applied at the upper layer of the grain Addition of CO2 and circulation ... protection has increased and stands as the main alternative to methyl bromide Lately, insect resistance to phosphine has become an important issue for effective grain treatment (Nakakita and Winks, 1981;...

Ngày tải lên: 25/10/2013, 05:20

... properly before processing is among the main reasons for contamination in fruit juice Washing and brushing fruit before the juicing step is common in juice processing According to one industry ... practices using chlorine and brushing only may be partially effective in controlling microbial contamination.9 The pathogens contaminating the fruit are not always located on the surface20 and are ... potential for microbiological contamination, including contamination with E coli, and therefore should be avoided.11–13 Another important source of E coli O157:H7 infections is drinking water...

Ngày tải lên: 25/10/2013, 21:20

... CD without increasing the risk of misclassification Preconditions are • • • • high quality serology including EMA taking quantitative antibody levels into account HLA typing full information to ... gluten and related prolamines  in genetically (mainly HLA) susceptible individuals  characterized by a combination of: • gluten dependent clinical manifestations • anti-tissue transglutaminase ... criteria for clinical decisions Formulate an answerable question Track down the best evidence Critically appraise the evidence for • Validity • Impact (size of the benefit) • Applicability Integrate...

Ngày tải lên: 22/03/2014, 09:20

... assumed  suddenly  increases  at  the breaking  point,  then  gradually  increases  towards  the shore,  and then decreases with the decrease in the water  depth in the following form:  ⎛ hm ⎞ ... Fig. 1. The coordinate system and method for the evaluation of a wetting and drying boundary.  The procedure  for determining  the cell  side  wetted  function  and the cell  area  wetted  function  in the numerical  ... of  the lost  wave  energy  is  transformed  into  turbulence  energy.  At  the beginning  of  the wave  breaking  process,  the turbulence  is  confined into a small portion of the breaking ...

Ngày tải lên: 28/03/2014, 15:20

... a theory of grammatical competence, in addition to being a useful technique for constraining parsing Conclusion Including the D-combinator rules in the CCG rule set lets us capture several linguistic ... This shows another instance of the schema in (1), which is undefined for any of the combinators in (3): The preceding data motivates adding D rules (we return to the distribution of the modalities ... Rules for D with appropriate modalities can therefore be incorporated seamlessly into CCG In the preceding subsection, we encoded Eisner NF with inert slashes In Baldridge’s CTL basis for CCG, inert...

Ngày tải lên: 31/03/2014, 00:20

... something in your personal domain In the Semantic Web, Anyone can say Anything about Any topic Explore the freedom Second Printing: Since the first printing there have been advances in several of the ... an informal organization to a large body of heterogeneous information The organization is informal in the sense that the interpretation of the tags requires human processing in the context of the ... disingenuous, “solving” the problem of node identity by relying on another standard to solve it On the other hand, since issues of identity appear in the Web in general and not just in the Semantic...

Ngày tải lên: 31/05/2014, 01:56

... 94°C for min, followed by 40 cycles at 94°C for min, 45°C for min, 68°C for and a final extension at 68°C for The PCR for GII was a denaturation at 94°C for min, followed by 40 cycles at 94°C for ... the miniblotter The remaining active esters on the membrane were hydrolyzed by incubation in 0.1 M NaOH for at room temperature and rinsed in water The membrane was washed twice for at 60°C in ... 48°C for 30 s, 72°C for and a final extension at 72°C for The PCR products were separated on a 2% agarose gel and visualized by ethidium bromide staining The PCR products for Genogroup I and Genogroup...

Ngày tải lên: 18/06/2014, 18:20

... filling the form and filing the report Informed consent should be obtained prior to filing report Once the report form is filed, it must be up to the labor inspectorate, the insurance scheme and/ or ... risk is defined to serve as basis for doubling, the notion is non-informative, hence a “floating unity” (Figure 1) Therefore, to avoid the problem of referring to doubling of the risk in expert-statements ... rate in males than in females can generally provide information as to why these differences occur In the 1970’s, male cancers of the nasal sinuses occurred with nine times higher incidence than in...

Ngày tải lên: 20/06/2014, 00:20

... 94°C for min, followed by 40 cycles at 94°C for min, 45°C for min, 68°C for and a final extension at 68°C for The PCR for GII was a denaturation at 94°C for min, followed by 40 cycles at 94°C for ... the miniblotter The remaining active esters on the membrane were hydrolyzed by incubation in 0.1 M NaOH for at room temperature and rinsed in water The membrane was washed twice for at 60°C in ... 48°C for 30 s, 72°C for and a final extension at 72°C for The PCR products were separated on a 2% agarose gel and visualized by ethidium bromide staining The PCR products for Genogroup I and Genogroup...

Ngày tải lên: 20/06/2014, 01:20

... Highlands, 8.9% for the Central Coast, and 2.1-3% for the Southeastern and the Southwestern) Goats in the Northern moutainous areas make up 48% of the country, and 67% of the North Most of them ... by other fingers by thumb and fore finger Hold the nipple by the whole hand Hold tightly by the whole hands Leave milk go down to the nipple 7.Do again the above process Milking by the thumb and ... Therefore, goat housing should be in east south direction for avoiding east north wind in winter and receiving east south wind in summer Materials for goat housing Materials for goat housing can be wood,...

Ngày tải lên: 21/06/2014, 06:20

... pleasure during the use of the visual monitoring aid and whether they found the monitoring aid helpful to improve their dance skills 4.4 Results The main results of the user study are displayed in Table ... in Section the technological and conceptual performance and future perspectives of the application Instruction method In concept, the Dance -the- Music brings the traditional demonstration-performance ... basic settings, like the music on which to perform, the tempo of the music, the number of steps per dance figure, the amount of training cycles, etc (see module and 2, Figure 1) Then, the teacher...

Ngày tải lên: 21/06/2014, 19:20

... 2 information from the PHY layer is allowed to in uence the operation of the MAC layer The second paper, “Exploiting transmit buffer information at the receiver in block-fading channels” by Dinesh ... feedback and feed-forward information in block fading channels TBIR is used at the receiver to efficiently quantize and report the state of the fading channel back to the transmitter The results ... Acknowledgments The editors would like to thank all the reviewers for their efforts in making this special issue They would also like to thank the Editor -in- Chief, and the editorial staff of Hindawi Publishing...

Ngày tải lên: 21/06/2014, 22:20

... of the project, on-going OIE workshops and highly effective on -the- job “hands-on” training of DAH personnel in the field during the course of the project The successful reduction of FMD in southern ... detailing the FMD serotype[s] in circulation and the ongoing vaccination history in each province included in the study was given in the earlier Milestone Report entitled; “Epidemiological and ... understanding of the incidence of specific serotypes in circulation in the field in Vietnam, the determination of the efficacy of vaccine coverage and has facilitated the identification of the risks...

Ngày tải lên: 22/06/2014, 12:20

... number of trainings/consultant for positions working in the packing house and farm owners/managers The contents of trainings and consultants are including: customers and customers’ demands; quality ... in which some major publishing listed below:  Handbook for GAP fruit Agricultural Publisher, 2007 production  Handbook for trainer for GAP fruit and vegetables (Training guidelines for trainer ... meeting to the quality manual and needed standards; Specification of position in the process and assumption the responsibility as the position description stated in the in the quality manual; training...

Ngày tải lên: 22/06/2014, 12:20

... synchronizing of the rulers and the clocks as the synchronizing of clocks in the special theory of relativity Firstly, we seek the relation between etalons at each point then convert the measured ... in a gravitational field of Mg To realize this, we should displace a standard ruler and a standard clock along the orbit of the particle.But when the ruler and clock move along the orbit in the ... be noted that the laws of conservation of linear and angular momentum not hold in noninertial reference frames due to the non-uniformity and anisotropy of space in these frames Finally, it can...

Ngày tải lên: 22/07/2014, 06:21

... data in predicting the scaling of link diameter, the theoretical volume-filling model (Eq (8)) poorly explained the link length in G sepium Although the fit was better in E lanceolata, in both ... exposed In addition to the data recorded for the roots in the complete root system exposure, the diameter difference between the point of insertion to root collar (below the initial thickening) and ... measured for all intact root segments, in relation with their order and link number, until the seventh order The consistency between the measurements of the radial and insertion angles measured before...

Ngày tải lên: 08/08/2014, 01:21

... the trivial representation s6 being the span of m222 inside Λ 4.3 Λ meets S S We begin by explaining the choice of normalizing coefficient in (16) Analyzing the abelianization map ab : T → S (the ... µr ) and ν = (ν1 , ν2 , , νs ) with r ≤ s, then the partition indexing the left-most term in mµ mν is denoted by µ ∪ ν and is given by sorting the list (µ1 , , µr , ν1 , , νs ) in increasing ... structural features of S and T Section describes the place-action structure of T and the original motivation for our work Our main results are proven in Sections and We underline that the harder part...

Ngày tải lên: 08/08/2014, 12:23

... prominences using 4-0 polyglactin (Vicryl suture, Ethicon), and the skin incision was closed in a running subcuticular fashion using 4-0 polyglactin suture Following recovery, the rabbits were inspected ... determine the nerve cross-sectional area, the myelinated axon count in each nerve cross-section, and the cross-sectional areas of the axons including their myelin sheaths In order to prevent grading ... and 15 mm proximally) and in the ulnar nerve (p < 0.0001 for distal end, 5, 10, and 15 mm group) Discussion Inspired by findings both in the laboratory and in the operating room, this study was...

Ngày tải lên: 10/08/2014, 10:20

... appropriate material for examining the temporary cavity The present model provides significant findings in the field of terminal wound ballistics and permits conclusions to be drawn about the surgical ... out CT and CBCT scans for clinical and systematic analyses; but the potential for systematic testing offered by gelatin blocks is far from having been fully exploited The present paper therefore ... the left) The gelatin blocks were fixed directly behind the dust chamber in the direction of fire The tests were performed with gelatin blocks (n = 12) They consisted of 20% porcine gelatin (Merck,...

Ngày tải lên: 11/08/2014, 20:21

... designed and coordinated the study and carried out the genetic analysis All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... CTTCATTTGTTATTCGACTT) and PVM2 (Forward: ATGGGAGATTCAACRAAGAA) were used for amplifying the entire CP gene and the nucleotide sequences of the amplicons (917 bp) were then determined in both directions using the ... tubers without the need to treat the tubers for breaking dormancy or to grow the tubers in greenhouse for leaf testing by ELISA In this paper we report on the analysis of the coat protein (CP) gene...

Ngày tải lên: 12/08/2014, 04:21