... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
Ngày tải lên: 23/03/2014, 13:20
... Norwegian Air Ambulance Foundation Author details Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, Norway 2Department of Anaesthesiology and Intensive Care, Stavanger ... safety) Materials and methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland ... statistical analysis and drafted the manuscript HML and ES helped design the study and draft and review the manuscript All authors have read and approved the final manuscript Competing interests The authors...
Ngày tải lên: 25/10/2012, 09:56
Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf
... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot
... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... countries of the WHO Eastern Mediterranean Region Egypt, Islamic Republic of Iran, Morocco, Pakistan and Sudan World Health Organization,Regional Office for the Eastern Mediterranean; 2004:76-80...
Ngày tải lên: 11/08/2014, 16:21
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx
... The relation of spinal x-ray to low back pain and physical activity among 60 year old men and women Spine 1985, 10:445-451 Lean ME, Han TS, Seidell JC: Impairment of health and quality of life ... data should anyone wish to examine the source As an example of an evidence summary see Table It is at this time that the clinician is ready for the final step of applying the evidence In our example ... degeneration in an urban population Ann Rheum Dis 1958, 17:388-397 Magora A, Schwartz A: Relation between the low back pain syndrome and x-ray findings I: Degenerative osteoarthritis Scand J Rehabil...
Ngày tải lên: 13/08/2014, 13:22
A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language
... pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17, ... than other forms of research Questionnaire is easy to analyze Data entry and tabulation for nearly all surveys can be easily done with many computer software packages Questionnaire is familiar ... has the capacity for great variety and advantages Varying vocal qualities adds interest and meaning to the messagesof the presenters The vocal characteristics of rate, volume, clarity, etc All...
Ngày tải lên: 19/03/2015, 10:37
An example of table content
... 6 Reference…………………………………………… Appendix: Questionnaire………………………… ...
Ngày tải lên: 15/10/2013, 03:11
Tài liệu Intelligent IP Network Value-Added Service ppt
... equipment and systems that enable valueadded services such as bandwidth on demand and application awareness These advanced services can be charged to the user with little or no impact on existing ... termination of the PPP session, it can still authenticate the user and communicate with the AAA server Valueadded services can be performed and additional user scenarios may be supported For example, ... the SG-1 and the BRAS: Network architecture can now provide service using the existing infrastructure, and the SG-1 can act as a service enhancement platform and as an additional BRAS The SG-1,...
Ngày tải lên: 10/12/2013, 20:15
Tài liệu An Example of Using the Get* Methods phần 1 pdf
... Console.WriteLine("ProductName database type = " + productsSqlDataReader.GetDataTypeName(productNameColPos)); Console.WriteLine("UnitPrice database type = " + productsSqlDataReader.GetDataTypeName(unitPriceColPos)); ... Console.WriteLine("ProductID database type = " + productsSqlDataReader.GetDataTypeName(productIDColPos)); This example displays: ProductID database type = int As you can see, the ProductID column is of the SQL ... type You can see this type correspondence in Table 9.3, shown earlier You can get the database type for a column using the GetDataTypeName() method of your DataReader object For example: Console.WriteLine("ProductID...
Ngày tải lên: 24/12/2013, 01:17
Tài liệu An Example of Using the Get* Methods phần 2 docx
... to use some of the methods shown in Table 9.7 An Example of Using the GetSql* Methods Let's take a look at an example that reads the ProductID, ProductName, UnitPrice, UnitsInStock, and Discontinued ... SqlDataReader productsSqlDataReader = mySqlCommand.ExecuteReader(); int productIDColPos = productsSqlDataReader.GetOrdinal("ProductID"); int productNameColPos = productsSqlDataReader.GetOrdinal("ProductName"); ... that you already have a SqlDataReader object named productsSqlDataReader and it may be used to read the columns from the Products table The following while loop uses the GetSql* methods and returned...
Ngày tải lên: 24/12/2013, 01:17
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
... objective of the FARM Program is to enhance the capabilities of GOs and NGOs, to build local capacity of resource poor farmers for sustainable use and management of agricultural and natural resources ... team-work and also multiple perspectives It gives the appreciative character of social organization of innovation In fact that SWG acts to bring a collaborative and linking among important actors ... research approaches to support the small-scale household farming in utilizing and managing of agricultural and natural resources reasonably Central elements in this participatory research are team-work...
Ngày tải lên: 16/01/2014, 21:20
Tài liệu BUILDING HIGH AVAILABILITY BROADBAND NETWORKS FOR VALUE-ADDED SERVICE DELIVERY ppt
... list/installation notes Floor plan diagram Cable rack diagram Fiber raceway diagrams Power and grounding diagrams • • • • • • • • • • • Top and bottom support diagrams Bay layout diagrams Shelf layout ... calls and meetings • Provide detailed status updates to the project team • Track and manage all dates • Manage and coordinate all material shipments • Schedule all customer site visits • Negotiate ... • Installation Services • Commissioning and Integration • Decommissioning and Removals Maintenance Services • Program and Project Management • Network and Inventory Audit • Preventive and Routine...
Ngày tải lên: 24/01/2014, 12:20
Tài liệu An Example of Communal Currency pdf
... out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case the amount ... remain out of the produce of the tax in any year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case ... without a loan and without the payment of interest It does not follow, however, that it was any more built without the aid of capital, than was St Paul's Cathedral or the Manchester Ship Canal Mr Harris,...
Ngày tải lên: 17/02/2014, 19:20
Writing a Business Plan: An Example for a Small Premium Winery potx
... coordinating winery operation and Manager maintenance, sales, marketing, financial record keeping, and staffing General Manager Coordinate winery operation and maintenance, sales, marketing financial ... Management January/February 1999 Barclay, Veronica “Are You Marketing to the Affluent.” Vineyard and Winery Management January/February 2000 Bizplanit www.bizplanit.com Bureau of Labor and Statistics ... experiences and January recommendations for a lawyer (3) Send to BATF and SLA for application packets January (4) Hire a lawyer to help with the application process February (5) Have all forms and paperwork...
Ngày tải lên: 15/03/2014, 21:20
Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunflower seeds: an example of peptide splicing docx
... chymotrypsin with a stoichiometry of : (analogues of and 7), whereas the two remaining analogues would inhibit both trypsin and chymotrypsin simultaneously and independently Jaulent and Leatherbarrow [11] ... splicing A Łegowska et al ˛ A B Fig MS spectra and results of HPLC analysis of (A) [FK]BiSFTI-1 (8) and (B) a mixture of b-trypsin and [FK]BiSFTI-1: peak 2, analogue without tripeptide Abu-Thr-Lys; ... 2486.4686 and 2762.4797 revealed the appearance of a : complex of trypsin with monocyclic SFTI-1 (Fig 3B) Essentially, an identical peak pattern was seen with an increasing incubation time of up...
Ngày tải lên: 29/03/2014, 09:20
Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt
... 2004) and changes in land-sea mask consistent with the latter, and an increase of psu to account for the ∼120 m sea-level lowering Vegetation and other land-surface characteristics as well as river-runoff ... (implying an oceanic subsurface warming) after one thousand years at 17 ka BP The star and circle indicate the location of the Hudson Strait ice stream mouth and source, respectively the annual mean ... induces a large iceberg discharge and an ice-stream acceleration that tranlates into up to m of sea level rise, with a maximum rate of mm yr−1 (the same order of magnitude as the present-day anthropically-induced...
Ngày tải lên: 30/03/2014, 16:20
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx
... reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international pooled model Finally, an IRT approach, in particular, that of ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection; ... together in a complementary way While the traditional approach provides relevant information regarding discriminant validity, missing values distributions and factor analyses loading, Rasch analysis...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" docx
... reliability analyses Exploratory and Confirmatory Factor analysis were performed to assess whether the Brazilian data fit the international pooled model Finally, an IRT approach, in particular, that of ... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection; ... together in a complementary way While the traditional approach provides relevant information regarding discriminant validity, missing values distributions and factor analyses loading, Rasch analysis...
Ngày tải lên: 20/06/2014, 16:20
báo cáo hóa học:" Reliability of 95% confidence interval revealed by expected quality-of-life scores: an example of nasopharyngeal carcinoma patients after radiotherapy using EORTC QLQ-C 30" pdf
... Medical Center, Taiwan Author Details 1Department of Pharmacy, Chi-Mei Medical Center, Tainan, Taiwan, 2Department of Hospital and Health Care Administration, Chia-Nan University of Pharmacy and ... 5Department of Radiation Oncology, Taipei Medical University, Shuang Ho Hospital, Taipei, Taiwan and 6Department of Emergency, Chi-Mei Medical Center, Tainan, Taiwan Received: 12 January 2010 Accepted: ... declare that they have no competing interests Authors' contributions WC, SJ and LF collected all data, generated the database, designed and performed the statistical analysis and wrote the manuscript...
Ngày tải lên: 20/06/2014, 16:20
Báo cáo hóa học: " REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries)" ppt
... (presentations available at project’s homepage) To enable further exchange of experiences and information about the research potential and capacities of local (Serbian) and regional research institutions and ... several aquatic and terrestrial acute and chronic toxicity tests using Vibrio fischeri, Pseudokirchneriella subcapitata, Caenorhabditis elegans, Lactuca sativa, Folsomia candida and Enchytraeus albidus ... subsessions, (a) legislative aspect; (b) emerging substances and nanomaterials: analyses, environmental fate, effects, ERA; and (c) incorporating omic information into risk assessment and policy) and (2)...
Ngày tải lên: 21/06/2014, 06:20