an equation containing the unknown function of a complicated argument

... Riemann hypothesis to the Ramanujan condition for a hypergraph Theorem 24 shows that a Riemann hypothesis is true if and only if the hypergraph is Ramanujan We will also show how our zeta function ... This gives us a complete characterization of the relation between the poles of the generalized Ihara-Selberg zeta function and the Ramanujan condition on a hypergraph We can rewrite the previous ... manipulate the factorization for theoretical results Theorem 10 makes it clear that the problem of factoring the generalized zeta function is really a problem of factoring the zeta function of...

Ngày tải lên: 07/08/2014, 13:21

... Ta adunata para anthropois dunata para to Theo estin.] Mark x 27 [Greek: Para anthropois adunaton, all' ou para Theo; punta gar dunata para to Theo] Matt xix 26 [Greek: Para anthropois touto adunaton ... panta, lego de humin, hoti Aelias aedae aelthe kai ouk epegnosan auton all' epoiaesan auto hosa aethelaesan Kai gegraptai hoti tote sunaekan oi mathaetai, hoti peri Ioannon tou Baptistou eipen autois.] ... under Barcochba; Judith is Judaea, Nebuchadnezzar Trajan; Assyria stands for Syria, Nineveh for Antioch, Arphaxad for a Parthian king Arsaces, Ecbatana for Nisibis or perhaps Batnae; Bagoas is the...

Ngày tải lên: 17/03/2014, 15:20

... after transplanting, the growth of the callus was compared (B) total DNA (20 lg per lane) isolated from 1, transformant; 2, nontransformant; 3, soybean (C) Top, adventitious embryo of the transformant, ... TyrA19 at the A- chain C-terminus, and ValB12 and TyrB16 at the B-chain central helix assume essentially the same spatial arrangements both in the locked, inactive state and in the unlocked state ... Science and Technology, and National Project on Protein Structural and Functional Analyses to H H., and a grant from the Bio-oriented Technology Research Advancement Institution, Japan to T Y We thank...

Ngày tải lên: 31/03/2014, 07:20

... formula for PA (t) in [I] Let us define QA (t) by pA (t) = PA (t) + QA (t) From the partial fraction expansion above, it is clear that QA (and hence also pA ) is a quasi-polynomial, that is, an expression ... by PA (t) and call the polynomial part of pA (t) It is easy to see that PA (t) is a polynomial of degree n − (More generally, the degree of PA,λ(t) is one less than the number of values of i ... Israilov, Numbers of solutions of linear Diophantine equations and their applications in the theory of invariant cubature formulas, Sibirsk Mat Zh 22 (1981), no 2, 121–136, 237 English translation:...

Ngày tải lên: 07/08/2014, 06:22

... desu neeb evah steksab ralucsav llams dna serans yrruC ,)ASU ,ekaL raeB etihW ,anevorciM( eranS kcenesooG ztalpmA eht ,enicidem namuh nI elbaliava era sloot laveirter etairporppa taht laitnesse ... ypocsoroulf lanimodba eht fo noitcejorp laretaL siht fo etar sseccus eht etad oT ADP llams a htiw sgod gnuoy ni ymotocaroht ot evitanretla evitceffe dna elpmis a si ,lioc noitazilobme na gnisu ,ADP a fo ... yretra ditorac eht ta decalp htaehs eht hguorht detresni saw )A3 giF ;ASU ,tosoR( pit lian eriw-eerht a htiw specrof ydob ngierof a ,htaehs eht gnicalp retfA eriw ediug eht hguorht detresni saw )ASU...

Ngày tải lên: 07/08/2014, 20:23

... regular, its spectrum can be computed from the zeta function The adjacency matrix A is always a real symmetric matrix, hence always diagonalizeable On the other hand, if G is regular then both Q and ... have the same zeta function Proof The pair were shown to have the same zeta function by evaluating Bass’ formula (2) for each graph with Mathematica, and showing that the resulting functions are ... direct calculation in mathematica shows the two graphs have equal zeta functions In Case 2, again a direct check using mathematica confirms that the two graphs have equal zeta functions To find the...

Ngày tải lên: 08/08/2014, 01:20

... formula, and discussed three different zeta functions of any graph Various proofs of Bass’ Theorem were given by Kotani and Sunada [7], and Foata and Zeilberger [3] Let G be a connected graph Then the ... zeta functions of graphs, and showed that the reciprocals of zeta functions of regular graphs are explicit polynomials A zeta function of a regular graph G associated with a unitary representation ... of the fundamental group of G was developed by Sunada [11,12] Hashimoto [4] treated multivariable zeta functions of bipartite graphs Bass [2] generalized Ihara’s result on the zeta function of...

Ngày tải lên: 08/08/2014, 01:20

... release, a sample of native flies was taken to determine the allelic frequencies in the natural population Another sample was taken at the end of release During the following weeks, new bananas ... electrophoresis and ADH activity was stained by the usual procedure, using isopropanol as a substrate II1 Results About 000 gcnitically-marked adults were released over a week in the close of the banana baits ... 588-590 adaptation OUIS -L CHEEMAECKER C., DE S M., 1977 Genetic latitudinal adaptation of Drosophila melanogaster : new discriminative biometrical traits between European and equatorial African populations...

Ngày tải lên: 09/08/2014, 22:23

... diagnosis of lung cancer, pneumonia, study withdrawal and death The 13 remaining patients (5 females and males) had an average age of 63 ± years (Tables 2) The anesthetic drugs used in the CABG group ... Statistical analysis was performed in Statistica version 7.0 (Stasoft Corporation, Tulsa, USA) Sample size was calculated and resulted in 10 patients, to achieve an alpha error of 0.05 and power of ... writing and editing RRTC, MS, PPSS and SLDC participated in the study design, data analysis, manuscript writing and editing ACLN supervised the study and contributed to the data analysis, manuscript...

Ngày tải lên: 10/08/2014, 09:21

... Perfluorodecaline may also have a role in the etiology of some changes, such as corneal oedema and deep corneal vascularization in the area of perfluorodecaline-endothelial contact It is known that corneal ... is aspirated from the anterior chamber [3] It is assumed that mechanical or the barrier effects of perfluorodecaline may cause the loss of cell density and morphological changes For these reasons, ... operation (a and b) Giant retinal tear with shallow detached retina involving the macula in the right eye (c) Reattachment of retina after vitrectomy sis, but could not obtain these results as the...

Ngày tải lên: 11/08/2014, 10:23

... Georgia Armenia Azerbaijan Belarus Kazakhstan Kyrgyzstan Ecuador Grenada Guatemala Guyana Haiti Honduras Jamaica Mexico Nicaragua Panama Paraguay Peru Puerto Rico Moldova El Salvador Russia Surinam ... Saudi Arabia Singapore Sri Lanka Syria Thailand Turkey UAE Yemen Vietnam China Taiwan Seychelles Algeria Sierra Leone Angola Somalia Benin South Africa Botswana Sudan Burundi Tanzania Cameroon ... Bangladesh Bhutan Brunei Cambodia Cyprus Hong Kong India Indonesia Iran Iraq Israel Japan Jordan Kuwait Laos Lebanon Macau Malaysia Maldives Mongolia Nepal Oman Pakistan Philippines Qatar Saudi Arabia...

Ngày tải lên: 12/10/2015, 17:36

... temperature and the large value range of the acoustic wave number qz The value of the AME current I is zero (the effect is not appear) when the small value range of the acoustic wave number qz and the ... acoustic wave numbers qz and on the parameters of the RQW with an infinite potential has been shown Numerical calculations are carried out with a specific GaAs rectangular quantum wire to clarify ... on the frequency ωqz of the acoustic wave, the mass of electrons, the temperature and the cross-sectional area of the RQW The curve of the AME current I strongly increases when the low temperature...

Ngày tải lên: 30/10/2015, 20:58

... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... stock company only sold famous brands that are Toshiba (Japanese), Mitsubishi (Japanese) Then recently it has expanded and started to sell other brands: Trane (American) and Sanyo (Japanese) This ... company specializes in selling the following: Air conditioners of famous companies such as Toshiba(Japanese), Mitsubishi(Japanese), Trane(American) and Sanyo(Japanese) Medical and technical equipment...

Ngày tải lên: 27/10/2012, 16:51

... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... Third Case Assume the following: • • • Cascade Update Related Fields is unchecked UpdateRule is set to None The CommandText of the Command object in the UpdateCommand of the DataAdapter is the same...

Ngày tải lên: 24/12/2013, 01:17

... neurofibrillary changes associated with AD Potential role of metal-binding/exchange properties of GIF in AD One of the primary pathological hallmarks of AD is the formation of b-amyloid (Ab) plaques, composed ... levels of GIF are altered dramatically in the neurodegenerative or traumatically injured brain The bestcharacterized example of this is for AD Indeed, many studies have analysed the amount of GIF present ... form of Ab(1–40) and suggests that it caused the de-aggregation of Ab In a therapeutic context, this indicates that MT might potentially promote the clearance of Ab plaques However, it is important...

Ngày tải lên: 16/02/2014, 15:20

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... resonance with GAPDH as analyte and CP12 as ligand (immobilized protein) The free energies of the association of GAPDH and CP12 were calculated according to equations and in the main text Analyte ... concentrations indicated on each curve of K12 8A mutant GAPDH, K128E mutant GAPDH, R19 7A mutant GAPDH, and R197E mutant GAPDH In all plots, the arrow on the left indicates the beginning of the association...

Ngày tải lên: 19/02/2014, 16:20

... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...

Ngày tải lên: 19/02/2014, 19:20

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... Steinman for the gift of E coli OX32 6A We finally thank Mr M Farrugia for photographic assistance REFERENCES Jackson, S.M & Cooper, J.B (1998) An analysis of structural similarity in the iron and manganese...

Ngày tải lên: 21/02/2014, 01:21

... Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, ... Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria 2 2 2 2 ... P (1981) Uric acid provides an antioxidant defense in humans against oxidant- and radical-causing aging and cancer: a hypothesis Proc Natl Acad Sci USA 78, 6858–6862 FEBS Journal 276 (2009) 5367–5379...

Ngày tải lên: 07/03/2014, 00:20

... four mutants and the four corresponding alanine mutants The least active mutants (i.e the alanine mutants) were deliberately purified using a column (washed with our standard protocol) that had been ... Asp140, Asp142, Glu144 and Asp215 were mutated individually to asparagine and alanine, Tyr10 and Tyr214 were replaced by Phe, and Ser93 was replaced by alanine All clones expressing ChiB variants ... in the pH 4.2– 8.0 range, and a marked increase in Km at alkaline pH (Table 2, Fig 3) The D215N and D140N mutants displayed an acidic shift in the pH-activity profiles, whereas the Y214F and the...

Ngày tải lên: 07/03/2014, 14:20