altered expression of sp c and familial ild in humans
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... cDNA by using the termoscript RT-PCR system (Gibco) according to the recommended protocol The CD1d gene was amplified by PCR using the following primers: 5¢-GGGCACTC AGCCAGGGGACATCCTGCCCAA-3¢ as ... prooxidant state caused by iron loading has an impact in protein integrity, as indicated by an increase in protein-bound acrolein adducts at the cell surface, which point to acrolein-adducts as a reliable ... forward and 5¢-GATACAAGTTTGCACACCTTTGCACTTCTG-3¢ as reverse [58] The PCR amplification was performed in a total volume of 50 lL reaction mix containing lL of cDNA, 10 pmol of each primer, 10· reaction...
- 14
- 682
- 0
Báo cáo y học: "Altered expression of membrane-bound and soluble CD95/Fas contributes to the resistance of fibrotic lung fibroblasts to FasL induced apoptosis" doc
... of the death inducing signaling complex (DISC) In addition, anti-apoptotic members of the bcl-family, e.g., Bcl-2, MCL-1 and A1, prevent the mitochondrial cytochrome c release Recently, the inhibitor ... the overexpression of the specific inhibitors of apoptosis X-chromosome-linked inhibitor of apoptosis (ILP) and FLICE-like inhibitor protein (FLIP) [16] http://respiratory-research.com/content/6/1/37 ... non-collagen ECM) The formula contains the factor 5.4 to correct for the 5.4-fold higher proline or hydroxyproline content of collagens compared with that of other proteins Induction and detection...
- 9
- 269
- 0
báo cáo hóa học: " Pharmacological inhibition of Akt and downstream pathways modulates the expression of COX-2 and mPGES-1 in activated microglia" potx
... 5’5’- TGTCTAATTTTGACCGTTTCTCTG-3’, Reverse 5’-TCATCTGCTCCGTCTACTTCTG3’; S12: Forward 5’-GCGCTTAAATACCGTCATGC-3’, Reverse: 5’- GACGCCGAATCTTGAACG-3’ To determine PGE2 and PGD2 concentrations, cells ... Glembotski CC, Rubin BB: MAP kinase kinase 6-p38 MAP kinase signaling cascade regulates cyclooxygenase-2 expression in cardiac myocytes in vitro and in vivo Circ Res 2003, 92:757-764 Mancini A, Jovanovic ... that could contribute to the enhancement of PGE2 and PGD2 Akt inhibition could enhance the expression and activity of PLA2 and COX-1, therefore enhancing the available arachidonic acid and PGH2,...
- 20
- 413
- 0
Báo cáo y học: "Expression of 5-lipoxygenase and 15-lipoxygenase in rheumatoid arthritis synovium and effects of intraarticular glucocorticoids" docx
... identified using a FACSCalibur (Becton Dickinson, San Jose, CA, USA) and Cell Quest software (Becton Dickinson) AA was added to a final concentration of 40 μM and the cells were incubated for minutes ... enzyme in CD3+ T cells or in CD20+ B cells (data not shown) The clinical response after intraarticular GC administration is associated with a decrease in 5-LO expression but not in 15-LO-1 expression ... important clinical and radiographic outcomes in RA [49] Intraarticular GC may also confer a bone-protecting effect in RA by decreasing the RANKL/ osteoprotegerin ratio [50] Previous studies have indicated...
- 11
- 484
- 0
Báo cáo khoa học:" Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pptx
... VCRT C1 7; (B), CCRT C4 ; (C) , CCRT C5 ; (D), CCRT C6 ; and (E), CCRT K4, were established which expressed human CD4 molecule, with human CXCR4 or CCR5, as indicated The expression of these surface ... and the C4 , C5 , and C6 derived clones expressing hCD4 and hCCR5 infected with HIV-1 BAL isolate; (C) , VCRT parental cell line and the derived C1 7 clone expressing human CD4 and CCR5 infected with ... CCRT and VCRT cells stably expressing hCD4 and hCCR5 receptors were produced by transduction of both cell lines with infectious, replication-incompetent, retroviral particles encoding hCD4 and...
- 9
- 329
- 0
Báo cáo khoa học: " Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pdf
... VCRT C1 7; (B), CCRT C4 ; (C) , CCRT C5 ; (D), CCRT C6 ; and (E), CCRT K4, were established which expressed human CD4 molecule, with human CXCR4 or CCR5, as indicated The expression of these surface ... and the C4 , C5 , and C6 derived clones expressing hCD4 and hCCR5 infected with HIV-1 BAL isolate; (C) , VCRT parental cell line and the derived C1 7 clone expressing human CD4 and CCR5 infected with ... CCRT and VCRT cells stably expressing hCD4 and hCCR5 receptors were produced by transduction of both cell lines with infectious, replication-incompetent, retroviral particles encoding hCD4 and...
- 9
- 251
- 0
Báo cáo sinh học: " Effects of recombinant adenovirus-mediated expression of IL-2 and IL-12 in human B lymphoma cells on co-cultured PBMC" pot
... is capable of controlling the disseminated disease Transgene candidates to potentially achieve that goal include genes encoding for cytokines, lymphotactic chemokines, allogeneic MHC molecules, ... feasible, induces increases in Page of (page number not for citation purposes) Genetic Vaccines and Therapy 2004, 2:15 proliferation rates and cytotoxic activity of co-cultured PBMC, and warrants ... Primary B-CLL cells were found to have moderate CAR expression of 36% In contrast, there was no CAR expression detectable in LAM53, IC, and CIK cells (Table 1) Expression of integrin receptors,...
- 8
- 602
- 0
Sphingosine kinase 1 regulates the expression of proinflammatory cytokines and nitric oxide in activated microglia
... GCCCATCCTCTGTGACT CAT iNOS GCTTGTCTCTGGGTCCT CTG β-actin TCACCCACACTGTGCCC ATCTACGA SphK1 CTTCTGGGCTGCGGCTC TATTCTG 5’ACTATATTCTCTTCTG S1P1 CACCAC 3’ 5’TGTCACTCTGTCCTTA S1P2 ACTC 3’ 5’CAACTTGGCTCTCTGC ... GGATGCCACAGGATTCCATAC CCA GGAAAGCAACCACGGGCACA 314 507 5’GCTTCGAGTCCTGACCCA 3’ 5’GGCCACTTGTCTCTCGAT 3’ 5’ACTGTTGGAGACAGACTGAA CG 3’ 5’ TGGAGACTTCTGCCCATT 3’ 5’CAGGTCCGACAAAGTGAG 3’ 29 80120 2.5 µl of cDNA ... 5’CAACTTGGCTCTCTGC S1P3 GACCT 3’ 5’CTCTACTCCAAGGGCT S1P4 ATGT 3’ 5’GTGTGTGCCTTCATTG S1P5 TG 3’ Antisense CGGACTCCGCAAAGTCTAAG Size (bp) 205 AGGCCACAGGTATTTTGTCG 229 CTCACTGGGACAGCACAGAA 217 GGATGCCACAGGATTCCATAC...
- 109
- 222
- 0
Báo cáo khoa học: Altered expression of tumor protein D52 regulates apoptosis and migration of prostate cancer cells potx
... 5¢-GATCCCCGCGGAA ACTTGGAATCAATTTCAAGAGAATTGATTCCAAGT TTCCGCTTTTTA-3¢ and reverse, 5¢-AGCTTAAAAA GCGGAAACTTGGAATCAATTC TCTTGAAATTGAT TCCAAGTTTCCGCGGG-3¢ MTT assay for cell proliferation The effect of ... TPD52 induces cell death in LNCaP cells Cells were transfected with speci c shRNA or control using LipofectamineÔ 2000 and cell death was measured by PI staining using fluorescence activated cell ... using recombinant psiCHECKÔ2-TPD52 vector Co-transfection of two vectors into LNCaP cells and luciferase assay after 24 h revealed that the following sequence is more speci c for antisense activity...
- 11
- 444
- 0
Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx
... contribution in the mechanism of IFN-resistance, HCV replication was eliminated from each cell line by treatment with Cyclosporine-A The success of Cyclosporine-A treatment and absence of HCV RNA in these ... amount of interferon specifically bound was determined by subtracting non-specific binding from total binding Specific binding of 125I-IFN-α2b to three groups of resistant cell lines and one sensitive ... replication and protein expression All nine replicon cell lines were cultured in a medium containing mg/ml of G-418 in the presence of cyclosporineA or IFN-α Their ability to form G-418 cell colonies...
- 13
- 305
- 0
Báo cáo khoa học: "Altered expression of thioredoxin reductase-1 in dysplastic bile ducts and cholangiocarcinoma in a hamster model" pptx
... rof desu erew sisnenis sihcronolC amonicracoignalohC :ChC tnemtaert NMD gnitaitini erofeb yad eno noitcefni fo eairacrecatem 51 ,ledom amonicracoignalohc retsmah eht roF locotorp latnemirepxE ... gniwollof ,amonicracoignalohc fo tnempoleved eht fo ssecorp eht ni RxrT fo ssol fo ecnatropmi dna msinahcem 512 ralucelom eht ,noitidda nI sisenegonicracoignalohc tsniaga noitneverpomehc rof elucelom ... sllec citsalpoen ehT )C- A3 giF( eussit evitcennoc fo noitcaer citsalpomsed gnidnuorrus yb deinapmocca sllec citsalpoen detaitnereffidnu fo steehs dilos ro serutcurts ralubut ralugerri gnimrof...
- 6
- 309
- 0
Báo cáo y học: "Altered expression of circadian clock gene, mPer1, in mouse brain and kidney under morphine dependence and withdrawal" pps
... structures that are known to be involved in drug addiction, including the limbic system, the dopaminergic neurons in the nucleus accumbens, and the arcuate nucleus, etc The exact role of the circadian ... that circadian rhythms of clock genes including mPer1 were maintained in the kidneys of SCN-lesioned mice [28] In feeding studies, it was found that feeding schedules could entrain the circadian ... products, in addition to the SCN In summary, the effects of morphine on the circadian clock gene, mPer1, seem to be organ specific In the brain, morphine increases the level of mPER1 expression and...
- 9
- 285
- 0
Báo cáo y học: "Altered expression of circadian clock gene, mPer1, in mouse brain and kidney under morphine dependence and withdrawa" docx
... many successive cycles (increasing frequency resolution) http://www.jcircadianrhythms.com/content/4/1/10 • Data collection should be automated Methods Our system consists of a closed-circuit television ... tuner and modular software pieces For the first component, we used a small, low-cost CCTV camera (LYD-80 6C CCD, Lianyida, China), capable of working at lux and mounted on a standard tripod This construction ... Journal of Circadian Rhythms 2006, 4:10 http://www.jcircadianrhythms.com/content/4/1/10 Figure of Activity a rat in L:D and D:D conditions Activity of a rat in L:D and D:D conditions Top: 3rd day in...
- 10
- 311
- 0
Tài liệu Báo cáo khoa học: Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx
... not humans [26] Fourth, regulation of the classical PDGFs after secretion includes covalent binding to the extracellular secreted protein, acidic and rich in cysteine (SPARC), which only binds ... prostate cancer was induced in mice, revealing a remarkable increase in contact between the prostate carcinoma cells and the stromal cells, which is critical for prostate cancer progression and metastases ... PDGF -C growth factor domain indicates the disulfide bridges in PDGF -C to consist of Cys250 and 294, Cys280 and 335, and Cys287 and 337, and the intermonomeric bonds to consist of Cys274 and 286...
- 19
- 557
- 0
Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt
... characterization, expression of recombinant toxic A-chain (rPAC) in Escherichia coli, and the in vitro association of the rPAC and recombinant pulchellin binding chain (rPBC) [22], which produces an active ... pulchellin A-chain (rPAC), recombinant pulchellin B-chain (rPBC), recombinant pulchellin (rPAB) and native pulchellin Spectra were obtained from each protein at a concentration of 0.3 mgặmL)1 in ... and cloning of the pulchellin A-chain gene fragment Expression, purication and characterization of the recombinant pulchellin A-chain Clones of several RIP-2 toxins, such as ricin and abrin have...
- 10
- 390
- 0
Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt
... protein truncated 159 aa from the amino terminus, was amplified by PCR using the following primers: forward, 5¢-CATGCC ATGGCGCCATTTTTCTTGAGACATGCC-3¢; reverse, 5¢-CTGGGATCCGTCCGAATCAGGTTCCTTC-3¢ ... closure), and intradomain and side-chain conformational changes, occur upon binding of ATP and nucleic acid to ensure ATPase activity Analysis of the mode of binding of ATP in the HCV NTPase/helicase ... opening or closing of domain 2, (c) inhibition of RNA (or DNA) substrate binding, (d) inhibition of unwinding by sterically blocking helicase translocation or (e) inhibition of coupling of ATP hydrolysis...
- 9
- 659
- 0
Báo cáo khoa học: Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme pdf
... results, the expression vector pLac1-B was selected to characterize the recombinant laccase from A niger Immunodetection of the recombinant laccase and expression of the corresponding gene in A niger ... laccase was checked on an SDS/polyacrylamide gel and the electrophoresis shows a single band of 70 kDa corresponding to a purified laccase (Fig 5) Analytical isoelectric focusing of the recombinant ... the laccase activity Study of the recombinant laccase production in A niger For both expression vectors, the laccase activity was found in the culture medium, indicating that laccase was secreted...
- 8
- 495
- 0
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx
... amplifying the hTRa1 cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGG AACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGG GTCGACGACTTCCTGATCCTCAAAGACCTC-3¢ In order to overexpress 4-1BB and TRAF1 in the HeLaTR cells, ... 4-1BB, 5¢-CCCGGGATATCATGGCCTCCAGCTCAGGCAG CAGTC-3¢ and 5¢-CCCGGGATATCTAAGTGCTGG TCTCCACAATGCACT-3¢ for TRAF1 precipitated by isopropyl alcohol Single-stranded cDNA was synthesized with lg of the ... HeLaTR/4-1BB and HeaLaTR/ TRAF1, respectively Primers for amplifying the 4-1BB and TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGA AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG CTTCACAGTTCACATCCTCCTTCTTCT-3¢ for...
- 10
- 491
- 0
Báo cáo khoa học: Increased sensitivity of glycogen synthesis to phosphorylase-a and impaired expression of the glycogen-targeting protein R6 in hepatocytes from insulin-resistant Zucker fa ⁄ fa rats pptx
... Greenberg CC, Freeman S, Poucher SM, Brady MJ & Agius L (2004) The glycogenic action of protein-targeting-to-glycogen in hepatocytes involves multiple mechanisms including phosphorylase inactivation and ... phosphorylase-a in fa ⁄ fa and Fa ⁄ ? hepatocytes (Figs 2C, 3B) could be explained by an increased activity of glycogen synthase phosphatase [13–15], because of increased expression of glycogen-targeting ... phosphorylase-a and glycogen synthesis Using three independent methods involving either expression of the muscle isoform of glycogen phosphorylase, or expression of the glycogen-targeting protein PTG or incubation...
- 11
- 360
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008