... presence of a small external field For the ZFC data, the magnetic moment rises more rapidly and attains a greater maximum value for the field applied parallel to the film surface This implies an easy magnetization ... qualitative agreement with the theoretical model of the ZFC magnetization of weakly interacting nanoparticle assemblies proposed by Azeggagh and Kachkachi [31] They show that within a Gittleman–Abeles–Bozowski ... confirm an in-plane easy magnetization axis as a consequence of significant dipole–dipole interactions The thermally activated spin relaxation is investigated by the ZFC/FC measurement of the temperature-dependent...
Ngày tải lên: 21/06/2014, 17:20
... that catalyze the polymerization of olefins and the addition of mercaptans to olefins The organic acids and the elements commonly found in the char can act as catalysts for many of these reactions ... increase during very mild hydrogenation 5.3 Limiting Access to Air and Antioxidants Although the small amount of air in the headspace of a sample did not appear to catalyze aging reactions, the ... organic acids such as oxalic acid (pKa = 1.3) and tartaric acid (pKa = 3.0) also catalyze acetalization, but acetic acid (pKa = 4.7) does not catalyze this reaction (Adams and Adkins 1925) Oxalic and...
Ngày tải lên: 19/06/2014, 14:02
Báo cáo khoa học: "Temporal and spatial variation in transpiration of Norway spruce stands within a forested catchment of the Fichtelgebirge, Germany" pdf
... similar to the 140-year stand and transpiration at these sites was related to D at the 140-year stand Precipitation was measured in an open field near the 140-year stand At the 140-year stand, rainfall, ... remain high and the needle area which must be supported by a particular sapwood area increases A similar effect of stand age on the leaf area/sapwood area ratio of stands was reported by Albrektson ... deep at the 40-year stand, the 40-year boggy stand and the 140-year stand, and with manually recorded tensiometers at 20 cm deep at the 40-year NE stand, the 70-year stand and the 110-year stand...
Ngày tải lên: 09/08/2014, 04:20
The Texture of Livelihoods Migration and Making a Living in Hanoi
... Acknowledgements The field research on which this paper draws was funded by The Challenges of the Agrarian Transition in Southeast Asia’ project, a Major Collaborative Research Initiative of the Social Sciences ... thousands of small farmers across northern Vietnam What we see happening in Hanoi and, by extension, in the Vietnamese countryside is the amalgamation of individual acts given force by the fact of their ... meaning of the term References ADB (2006) Vietnam: Poverty assessment Manila: Asian Development Bank ADB (2011) Key indicators for Asia and the Pacific 2011 Manila: Asian Development Bank Agergaard,...
Ngày tải lên: 16/12/2017, 00:53
CONSTRUCT VALIDATION OF THE JOB PERFORMANCE MEASUREMENT a CASE OF THE MALAYSIAN PUBLIC SERVICE AGENCIES
... Exploratory factor analysis An exploratory factor analysis was carried out to examine the factorial validity of the Bahasa Malaysia adaptation of the job performance items Exploratory factor analysis ... were usable for data analysis Back translation of the items The translation of the original English version of the questionnaire into Malay language was accomplished through back translation procedure ... Maklumat perjawatan dan pengisian sektor awam Putrajaya: Author Retrieved March, 2007, from http://www.jpa.gov.my/imapsa/Default.aspx?alias=www.jpa.gov.my/i-mapsa/perangkaan Malek, S (2006, August...
Ngày tải lên: 11/09/2013, 11:44
Tài liệu Control the Creation and Behavior of Classes Now that you have code that can prepare all of the pdf
... sets the class-level variables to the state of the data row, you could also use it as the basis of a cancel or reset method Remember: The dataset stores data as XML, and it does not require an active ... fundamental problems in Visual Basic database development is how to interpret null values in the database within Visual Basic code, and viceversa In the database, a null value is a null value, and ... means that the variable was never initialized An uninitialized variable is quite different from a database null value and could just as easily signify a runtime bug as a null value In either case,...
Ngày tải lên: 24/12/2013, 06:17
Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx
... In analysis, data were compared graphically and by an ANOVA analysis at the significant level α = 0.05 to test for differences (Neter et al., 1996) The visual appearance of the sand in CSFW was ... Soil organic matter (OM) is the organic fraction of soil, including wastewater pollutants, plant roots, animal and plant residues, and microbial biomass OM influences the chemical and physical properties ... properties of soils even at the relatively low amount usually found in soils The macrophyte plants transport approximately 90% of the oxygen available in the root zone (Lee, 2007) Such the oxygen in the...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu Real-time, on-line monitoring of organic chemical reactions using extractive electrospray ionization tandem mass spectrometry pdf
... while other parameters were maintained at default values as suggested by the manufacturer By taking into account the dead volume of the transporting line after adding all reactants and the flow rate ... monitoring of trace amounts of chemicals We have extended the application of EESI to instantly follow organic chemical reactions in a straightforward manner, with a rather simple setup Two important chemical ... (e.g heterogeneous chemical reaction, and reactions involving catalysts) Compared with other available techniques, EESI-MS allows a better control of chemical and pharmaceutical reactions due to...
Ngày tải lên: 14/02/2014, 08:20
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... is apparently disadvantageous electrochemically and ⁄ or spatially for the interaction with BPA or 4-OHT Glu has the -CH2COOH (carboxymethyl) group on the b-carbon of the Ala side chain, whereas ... interactions Simultaneous mutation of these residues to Ala eliminated activity in binding to a BPA molecule, and individual mutations drastically reduced the activity Because Ala lacks the characteristic ... BPA (1 and 10 lM) against the inverse agonist activity of 4-OHT (1 and 10 lM) The assay set marked with an asterisk shows the the inverse antagonist activity of BPA for lM 4-OHT, and the other...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu The Value of the Case Study as a Research Strategy doc
... researchers are to be able to repeat a research programme: It is for this reason that researchers like Yin are especially adamant that a case database be created and maintained to \allow repetition and ... find a variety of 'quasi-statistical' methods If this is the case, is there really a clear distinction between qualitative and quantitative research? It seems that a line of demarkation may be ... that the application of the methodology is as likely (perhaps inherently) at fault as the methodology itself Qualitative research as preparation - As mentioned above, qualitative research has a...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
... and the relevant mutant E1 In all assays, the E1aS283C and E1aF26 6A mutants behaved essentially the same as wild-type E1 In the DCPIP assay, the E1aY28 1A and E1aR28 2A mutants displayed a catalytic ... Function of the mutated amino acids The E1aY281 and E1aR282 mutants of B stearothermophilus E1 show a higher Vmax in the DCPIP assay, no change in activity in the reductive acetylation assay and a significant ... mixture with E1 was incubated for exactly 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants were...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
... the sides of the small mineral particles In the five-layered model of nacre organic matrix organization [7,60] the surface layers, also called the ÔenvelopeÕ by the authors, are the aspartic acidrich ... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... Almeida, M.J., Milet, C., Lopez, E & Giraud, M (2001) Characterization and quantification of chitosan extracted from nacre of the abalone Haliotis tuberculata and the oyster Pinctada maxima Mar...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGTAC GC-3¢, respectively The ... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain SUT2 as the ... yeast/info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... Splice acceptor Phase of intron acag|gtaag tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not in coding region I I II (2929) (986) (1985) (1490) Table ... (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢) for amplification of the region from )180 to )36 and (5¢-GAAGAT CTAACTAGATTTTACCATTGG-3¢) for amplification of the region from )180 to )72, respectively The ... 2) Analysis of the phase of each of the xMGP introns located within the coding region revealed that introns and are of phase I while intron is of phase II [29] The same phases are found in the...
Ngày tải lên: 08/03/2014, 10:20
Glimpses of the Past History of the River St. John, A.D. 1604-1784 ppt
... with caution On the other hand the friends of Charnisay have cast aspersions an the character of Lady la Tour that seem entirely unwarranted.[2] The fact remains that Acadia, large as it was, not ... youngest of the quartette, came to Acadia rather later than his brothers and was granted a seigniory at Canibecachice (Kennebecasis), a league and a half along each side of the river and two leagues ... The native races naturally play a leading part in early Acadian history, nor they always appear in a very amiable light The element of fierceness and barbarity, which seems inherent in all savage...
Ngày tải lên: 08/03/2014, 13:20
the importance and effective of the ethical principles within an organization (business) to curb fraudulent
... international accounting and transparency of financial statements easily achieved because: To ensure the stability of financial markets and capital markets, regulatory agencies have raised the issues of ... Executive Officer CFO Chief Financial Officer EPS Earnings Per Share FS Financial Statements GAAS Generally Accepted Auditing Standard GAAP Generally Accepted Accounting Principles IFAC International ... when a company manipulates its financial statements, the market value of that company's stock usually drops considerably, sometimes by as much as 500 times the amount of the fraud Six of the top...
Ngày tải lên: 13/03/2014, 14:20
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh
... mistake, you can casually tell students it was just a test! A variation of the Surprise Principle is called the "information gap" When students all use the same textbook, they already have the same ... memorization of conversations In fact, speaking activities in a traditional classroom often take place, in the way of one person asking a question and another giving an answer As a result, the questions ... drive a car Students who are answering without thinking will say "yes" automatically In such cases, their classmates will usually laugh at their mistake, 22 and they will realize the importance of...
Ngày tải lên: 15/03/2014, 10:03
314 CMR 9.00: 401 WATER QUALITY CERTIFICATION FOR DISCHARGE OF DREDGED OR FILL MATERIAL, DREDGING, AND DREDGED MATERIAL DISPOSAL IN WATERS OF THE UNITED STATES WITHIN THE COMMONWEALTH potx
... writing that either because of the nature of the proposed activity, the amount of the material, and/or the characteristics of the material that the material requires management as a solid waste subject ... by the Department vii The applicant shall assure that at least 90% of the CAD surface area shall include a “clean layer” whose vertical thickness contains at least 70% sand or other approved capping ... to the maximum extent practicable shall demonstrate that: They have made all reasonable efforts to meet each of the standards; They have made a complete evaluation of possible stormwater management...
Ngày tải lên: 15/03/2014, 16:20
Research " TRANSFER OF TRAINING: AN INVESTIGATION WITHIN A TEAM WORK ENVIRONMENT " potx
Ngày tải lên: 16/03/2014, 03:20
Báo cáo khoa học: Conformational properties of bacterial DnaK and yeast mitochondrial Hsp70 Role of the divergent C-terminal a-helical subdomain pdf
... the primers: 5¢-CCCGCCATGGGTAAAATAATTGGTA TCG-3¢ and 5¢-CCCGGATCCAAGCTTTTACTGCTTAG TTTCACCAGA-3¢ The PCR fragments were cloned into the bacterial expression vector pTrc9 9A (Amersham Pharmacia ... Hsp70Ỉ F-APPY and the kobs value was plotted against Hsp70 concentration to obtain the binding parameters k+1 and k-1 Refolding of chemically and thermally denatured luciferase Chemical denaturation ... interhelical interactions Thus, the sequence and conformational variability of the a- helical subdomain might be an important factor for maintaining the conformation of the whole PBD and modulating the...
Ngày tải lên: 16/03/2014, 22:20