akt erk1 2 and their downstream targets during rv infection
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx
... Virology Journal 20 05, 2: 2 17 18 19 20 21 22 23 24 25 26 27 28 http://www.virologyj.com/content /2/ 1 /2 Gamma -2 and Betaherpesviruses in Mandrill and Drill Monkeys J Virol 20 00, 74 (24 ):11993-11999 ... PcyRV2 -5000 20 -5000 22 24 26 28 30 32 34 36 38 40 42 44 Cycles Figure Comparison of the RV2 QPCR assay using different rhadinovirus templates diluted in genomic DNA Comparison of the RV2 QPCR ... TCTGAATATGTCACATCCGTTCATA .G .G .G RV2 b Primer RV2 -FAM Probe RV2 RRV MneRV2 MfaRV2 PcyRV2 TGATAAT C C A TGATCTGTAGTCCCCATGTGTCC T T A RV1 RFHVMm RFHVMn KSHV C A T CACA T.G GAGA...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot
... Virology Journal 20 05, 2: 2 17 18 19 20 21 22 23 24 25 26 27 28 http://www.virologyj.com/content /2/ 1 /2 Gamma -2 and Betaherpesviruses in Mandrill and Drill Monkeys J Virol 20 00, 74 (24 ):11993-11999 ... PcyRV2 -5000 20 -5000 22 24 26 28 30 32 34 36 38 40 42 44 Cycles Figure Comparison of the RV2 QPCR assay using different rhadinovirus templates diluted in genomic DNA Comparison of the RV2 QPCR ... TCTGAATATGTCACATCCGTTCATA .G .G .G RV2 b Primer RV2 -FAM Probe RV2 RRV MneRV2 MfaRV2 PcyRV2 TGATAAT C C A TGATCTGTAGTCCCCATGTGTCC T T A RV1 RFHVMm RFHVMn KSHV C A T CACA T.G GAGA...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo y học: "Human rheumatoid arthritis tissue production of IL-17A drives matrix and cartilage degradation: synergy with tumour necrosis factor-α, Oncostatin M and response to biologic therapies" ppt
... Stimulates the production 21 22 23 24 25 26 27 28 29 30 31 32 33 and expression of proinflammatory cytokines, IL-b and TNF-a by human macrophages J Immunol 1998, 160:3513-3 521 Yao Z, Fanslow WC, ... protein expression in hepatocytes and smooth muscle cells via p38 MAPK and ERK1/ 2- dependent NF-kappa B and C/EBPbeta activation J Biol Chem 20 07, 28 2 :27 229 -27 238 39 Joosten LA, Radstake TR, Lubberts ... for Th1 and Th17 cell J Exp Med 20 08, 20 5 :24 91 -24 97 64 Wendling D, Cedoz JP, Racadot E: Serum and synovial fluid levels of p40 IL 12/ 23 in spondyloarthropathy patients Clin Rheumatol 20 08, 28 :187-190...
Ngày tải lên: 09/08/2014, 14:22
Reactive oxygen species mediated regulation of the na+ h+ exchanger, NHE 1 gene expression a new mechanism for tumor cells resistance to apoptotic cell death
... intracellular levels of O2.- and H2O2 (Pervaiz S and Clement MV, 20 02 and 20 04; Clement MV and Pervaiz S, 1999 and 20 01) Interestingly, an increase in intracellular O2.- concentration achieved ... siRNA transfection 83 Fig 24 Rac-induced cell survival is dependant upon NHE-1 expression 84 viii Fig 25 H2O2 inhibits NHE-1 promoter activity in NIH3T3 cells 86 Fig 26 H2O2 treatment of NIH3T3 cells ... Apoptotic machinery I .2 Reactive oxygen species and apoptosis I .2. a Pro and Anti-Apoptotic functions of ROS I .2. b Rac1 and superoxide anion production 11 I .2. c Superoxide anion and inhibition of...
Ngày tải lên: 16/09/2015, 08:31
Báo cáo y học: "Gene Therapy: The Potential Applicability of Gene Transfer Technology to the Human Germline"
... 6(4) :21 1 -22 8 Morgan RA, French Anderson W Human Gene Therapy Annu Rev Biochem 1993; 62: 191 Hu WS, Pathak VK Design of retroviral vectors and helper cells for gene therapy Pharmacol Rev 20 00; 52( 4):493-511 ... Acad Sci U S A 20 02; 99(4) :21 40 -21 45 24 Cornetta K, Morgan RA, Anderson WF Safety issues related to retroviral-mediated gene transfer in humans Human Gene Ther 1991; 2( 1):5-14 25 Gunter KC, Khan ... 1998; 95 (24 ):14 028 -14033 32 Chan AWS, Chong KY, Martinovich C, et al Transgenic monkeys produced by retroviral gene transfer into mature oocytes Science 20 01; 29 1(55 02) :309-3 12 33 Gandolfi F...
Ngày tải lên: 03/11/2012, 10:01
DEVELOPING, USING AND ANALYZING THE RESULTS OF INTERVIEWS TO DETERMINE THE FEELINGS OF FOREIGN TOURISTS ON THEIR VISIT TO VIET NAM
... designed an interview of 25 questions and divided into 10 main topics: Background Reason for travel Tourist sites visited or intending to visit Tourist services used Sources of information and how useful ... Therefore, they spend more time and money for travelling, and for relaxing in some Southern Eastern Asian countries: Thailand, Singapore, Laos, Cambodia, and Vietnam And the reason why the north ... disappointed and did not want to go at all And we continued finding other guests, but not much tourist, so we could interview one to two travelers Most of them seemed too closed, to be friendly and warmhearted,...
Ngày tải lên: 25/04/2013, 15:42
Trắc nghiệm tổng hợp vecto-10
... u;u 63/ Cho A (2 ; -1) , B(0 ; 3) , C(4 ; 2) Một điểm D có tọa độ thỏa AD + BD - CD = Tọa độ D là: a D(1 ; 12) c D( 12 ; -1) d D(- 12 ; -1) r r b D( 12 ;r1) r r r 64/ Cho ba vectơ a = (2 ; 1) , b = ... ( −5 ; 12 ) d x = ( ; - 12 ) 2 ur uu ur uu uu ur 62/ Cho A (2 ; 5) , B(1 ; 1) , C(3 ; 3) , điểm E mặt phẳng tọa độ thỏa AE = AB - AC Tọa độ E : a E(3 ; -3) b E (-3 ; 3) -3) d E( -2 ; -3) ... B(1 ; -3) Tọa độ giao điểm I hai đường chéo hình bình hành OABC : 2 ; ÷ 3 5 1 ; ÷ c I (2 ; 6) 2 2 23 74/ Cho A(1 ; 2) , B(3 ; ) C(6 ; ) Tìm câu câu sau ? a A, B, C thẳng hàng b A, B,...
Ngày tải lên: 20/07/2013, 01:27
A New Technique Using Headspace Gas Monitoring to Determine Carbon Source Addition in a BNR Process
... Ti e m 7.65 7.60 7.55 pH CO2 ppm J 120 6-0-CO2 7.50 7.45 7.40 7.35 120 140 160 180 20 0 Time elapsed (min.) 7.30 100 120 140 160 180 20 0 Time elapsed (m in.) Figure CO2 and pH profiles of NaAc addition ... utilized directly in the reactions - 64 - J0515-1 and -2 250 CO2 (ppm ) 300 20 E Tim e (m in.) 25 15 10 NaAc 20 0 150 TAD 100 R = 0.9977 n=7 50 0 10 20 30 10 20 30 Time elapsed (min.) NaAc Conc m g/L ... Spike and sampling KOH Flowmeter P Fill pump Figure Experiment setup of CO2 headspace monitoring - 62 - CO2 verify-1 (n=16) 1400 120 0 CO2 (ppm ) 1000 800 600 y = 175.54x R = 0.9998 400 20 0 0.0 2. 0...
Ngày tải lên: 05/09/2013, 08:40
Use of an extension of the park's transformation to determine control laws applied to a non sinusoidal permanent magnet synchronous motor
... (figure 2) : 1 ~ 100 21 0 24 0 t ora Figure 3: @ I m , @Irp , p and @Irq the position of the rotor versus Several control laws have been simulated with this motor and their performance compared 120 0 ... positive voltage E during the 120 " inkrval of electrical angle where Wra is near of its maximal value @', supplied with a negative voltage -E during the 120 " interval of eltvtrical angle where ... ib and i, and the ideal currents i, rd, nf and i, nf (figure 6b) ib voltage during the s W y state The "dq" frame is better than " a h " frame It need more complex implementation, but the band...
Ngày tải lên: 03/01/2014, 19:50
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx
... effects of C282Y and H63D mutations on FEBS Journal 27 7 (20 10) 321 9– 323 4 ª 20 10 The Authors Journal compilation ª 20 10 FEBS L Bhatt et al 11 12 13 14 15 16 17 18 19 20 21 association with beta2-microglobulin, ... it to the cell surface and is unable to exert this control We wanted to determine FEBS Journal 27 7 (20 10) 321 9– 323 4 ª 20 10 The Authors Journal compilation ª 20 10 FEBS 322 5 N-Glycosylation of HFE ... binding of transferrin, and that little or no reduction in transferrin binding was observed in cells expressing the HFE-C282Y mutant (Fig 7A) FEBS Journal 27 7 (20 10) 321 9– 323 4 ª 20 10 The Authors Journal...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence doc
... Oncogene 15, 25 89 25 96 14 Wang X, Pan L, Feng Y, Wang Y, Han Q, Han L, Han S, Guo J, Huang B & Lu J (20 08) p300 plays a ZBP-89 affects senescence through p16 15 16 17 18 19 20 21 22 23 24 25 26 role ... through p21 and p53 [2] , and the restraint of cell senescence through p16, as shown in this study FEBS Journal 27 6 (20 09) 4197– 420 6 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 420 1 ZBP-89 ... real-time quantitative PCR and the 2( -Delta Delta C(T)) Method Methods 25 , 4 02 408 FEBS Journal 27 6 (20 09) 4197– 420 6 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 420 5 ZBP-89 affects senescence...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: Differing molecular mechanisms appear to underlie early toxicity of prefibrillar HypF-N aggregates to different cell types potx
... 1 .22 0.83 1 .22 2. 20 2. 69 8.50 7.70 16.86 20 .20 23 .51 0 .28 0.98 1.63 0.93 0.73 0.60 ± ± ± ± ± ± 0.15 0.09 0.15 1. 02* 0.77 0.87 ± ± ± ± ± ± 0.57 1.09 1.54 0.46 1.01 2. 36 ± ± ± ± ± ± 1. 92 2. 12 3. 92 ... stress and protein aggregation during biological aging Exp Gerontol 36, 1539– 1550 FEBS Journal 27 3 (20 06) 22 06 22 22 ª 20 06 The Authors Journal compilation ª 20 06 FEBS 22 21 Apoptotic pathways in HypF-aggregate-treated ... poly (ADP-ribose) synthesized in vitro and in vivo Anal Biochem 25 9, 28 0– 28 3 FEBS Journal 27 3 (20 06) 22 06 22 22 ª 20 06 The Authors Journal compilation ª 20 06 FEBS ...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo Y học: Matrilysin (matrix metalloprotease-7) cleaves membrane-bound annexin II and enhances binding of tissue-type plasminogen activator to cancer cell surfaces docx
... (stromelysin-1) and matrix metalloproteinase-7 (matrilysin) J Biol Chem 27 6, 28 261 28 267 Li Q, Park PW, Wilson CL & Parks WC (20 02) Matrilysin shedding of syndecan-1 regulates chemokine mobilization and ... nonreducing ()) and reducing (+) conditions 2ME, 2- mercaptoethanol The bands at 72 and 36 kDa correspond to dimeric and monomeric forms of annexin II, respectively (B) The natural annexin II (2 lgÆmL)1 ... EMBO J 9, 420 7– 421 3 27 de Munk GA, Caspers MP, Chang GT, Pouwels PH, Enger-Valk BE & Verheijen JH (1989) Binding of tissue-type plasminogen activator to lysine, lysine 4 822 28 29 30 31 32 33 34...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo khoa học: Wild-type p53 enhances annexin IV gene expression in ovarian clear cell adenocarcinoma docx
... DE, Wu R, Zhai Y, 14 82 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Darrah DM et al (20 02) Gene expression in ovarian cancer reflects both morphology and biological behavior, distinguishing clear ... Protein and total RNA were extracted from various EOC cell lines, HEK293 and LNCaP cell lines (A, B) Expression levels of protein and mRNA, and levels of p53, ANX4 and the known p53 targets, p21 and ... nucleotide positions at +180 and +27 0 are denoted by filled and unfilled triangles, respectively 14 72 FEBS Journal 27 8 (20 11) 1470–1483 ª 20 11 The Authors Journal compilation ª 20 11 FEBS Y Masuishi et...
Ngày tải lên: 22/03/2014, 16:20
Cancer Research UK’s strategy 2009–2014: Cancer Research UK’s aim is to reduce the number of deaths from cancer. Our future plans are ambitious, but they are in line with the challenge and the responsibility we face. docx
... 20 09 20 14 19 20 Information We enable and encourage people to make informed choices that will reduce their risk of cancer, increase their chances of early detection, understand their cancer and ... Colon 40 Ovary Leukaemia 30 20 Myeloma Stomach Brain Lung Pancreas 10 1971- 72 Year 1980-81 1990-91 20 00- 02 *15-99 years **Coleman M (20 07) 20 20 goals launch Causes and prevention Our researchers ... Contents 10 12 20 24 26 28 Foreword Introduction Our achievements Our vision, purpose and goals Our core strategies Research Information Influencing public policy Partnerships and people Our...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo khoa học: Transcription factor specificity protein 1 (SP1) and activating protein 2a (AP-2a) regulate expression of human KCTD10 gene by binding to proximal region of promoter pot
... by Sp1 and AP2 J Biol Chem 27 4, 28 794 28 8 02 FEBS Journal 27 6 (20 09) 1114–1 124 ª 20 09 Hunan Normal University Journal compilation ª 20 09 FEBS 1 123 SP1 and AP-2a regulate KCTD10 R Liu et al 29 Chen ... of the Drosophila SP1 and AP-2a regulate KCTD10 16 17 18 19 20 21 22 23 24 25 26 27 28 TFIID complex and mediates transcriptional activation Proc Natl Acad Sci USA 91, 1 92 196 Chiang CM & Roeder ... 27 6 (20 09) 1114–1 124 ª 20 09 Hunan Normal University Journal compilation ª 20 09 FEBS 1115 SP1 and AP-2a regulate KCTD10 R Liu et al A B Fig Genomic structure of human and mouse KCTD10 genes, and...
Ngày tải lên: 30/03/2014, 02:20
Báo cáo khoa học: Leishmania donovani bisubunit topoisomerase I gene fusion leads to an active enzyme with conserved type IB enzyme function doc
... conserved constellation of the catalytic residues (Arg314, Lys3 52, Arg410 and His453 of LdTOPIL and the consensus catalytic residue Tyr 222 in LdTOPIS) share a common module between Leishmania and ... Escherichia coli BL21(DE3)pLysS cells harboring pET28cLdTOPIL-fus-S, pET28cLdTOPIS-fus-L, pET28cLdTOPIL-fus-D(1 21 0)S, pET28cLdTOPIL-fus-S(H453A), pET28c LdTOPIL-fus-S(H453Q), pET16bLdTOPIL and pET16b ... overexpressed proteins from Escherichia coli BL21(DE3)pLysS cells harboring plasmids pET28cLdTOPIL-fus-S, pET28cLdTOPIS-fus-L and pET28cLdTOPIL-fus-D(1 21 0)S (1 21 0 amino acid deletion mutant from the...
Ngày tải lên: 30/03/2014, 10:20
introduction to p-adic numbers and p-adic analysis - a. baker
... CONGRUENCES AND MODULAR EQUATIONS Example 1.16 When p = 2, we have the groups (Z /2) × = {1}, Z /22 × Z /23 = {1, 3, 5, 7} ∼ Z /2 × Z /2, and in general = Z/2r+1 for any r × × = {1, 3} ∼ Z /2, = ∼ Z /2 × Z/2r−1 ... n1 , n2 > M then ε ˆ N (αn1 − αn2 ) < ; thus ˆ ˆ N (cn1 − cn2 ) = N (an1 k(n1 ) − αn1 ) + (αn1 − αn2 ) + (αn2 − an2 k(n2 ) ) ˆ ˆ ˆ N (an1 k(n1 ) − αn1 ) + N (αn1 − αn2 ) + N (αn2 − an2 k(n2 ) ) ... k(m) − an k(n) ) + N (am k(m) − αm ) < + = ε 2 Hence we see that ˆ N (γ − αm ) < ε ∀m > M Lemmas 2. 23 and 2. 24 complete the proof of Theorem 2. 22 We will now focus attention upon the case of...
Ngày tải lên: 31/03/2014, 15:19
