MUTUAL BANKING: SHOWING THE RADICAL DEFICIENCY OF THE PRESENT CIRCULATING MEDIUM, AND THE ADVANTAGES OF A FREE CURRENCY docx

MUTUAL BANKING: SHOWING THE RADICAL DEFICIENCY OF THE PRESENT CIRCULATING MEDIUM, AND THE ADVANTAGES OF A FREE CURRENCY docx

Ngày tải lên : 29/03/2014, 08:20
... serve as a standard of value: but the bill of a Mutual Bank, having a legal value only, and not an actual one, cannot serve as a standard of value, but is referred, on the contrary, to silver and ... a fair day's wages, and that one man by a certain process can produce an article valued in the market at one dollar in half a day's labor, other men will take advantage of the same process, and ... nearly and so constantly as those of the precious metals; and it is for this reason that they have been adopted by the various nations as standards of value When Adam Smith and Malthus8 say that...
46 327 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Ngày tải lên : 19/02/2014, 16:20
... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... fraction is designated as the mitochondrial fraction Immunochemical assays and antibodies Mitochondrial protein samples (between 50 and 100 lg) were separated by SDS/PAGE and BN/PAGE and transferred ... assembly of an active mammalian mitochondrial complex I Experimental procedures Cell lines and cell culture The isolation and preliminary biochemical and genetic characterization of a series of respiration-deficient...
9 622 0
Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-affinity substrate for H+/peptide cotransporters pdf

Ngày tải lên : 07/03/2014, 05:20
... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table 1) Glycine, ... UK) Dexamethasone, apotransferrin, Gly-Gln, AlaAla, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenhofen, ... as means ± standard error, n ¼ Lys[Z(NO2)]-Val, Lys(4-nitrobenzyloxycarbonyl)-Val Compound Bip-[3H]Pro uptake (%) Control Gly Gly-Sar Bip-Pro Ala-Ala Pro-Ala Lys-Lys Ala-Asp D-Phe-Ala Ala-Ala-Ala...
10 490 0
Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

Ngày tải lên : 07/03/2014, 16:20
... purication and characterization of the recombinant pulchellin A- chain Clones of several RIP-2 toxins, such as ricin and abrin have been obtained in other laboratories and shown to From A pulchellus ... based on DNA sequences obtained previously Thus, the sequences of the primers used for 5Â RACE were: 5Â-GGGCATCACGGA AGAAATAG-3Â for a reverse transcription and 5Â-GC TCTAGAGCATTCGTCACATCGATACC-3Â ... enzymatic activity of rPAC Figure shows an Fig Deduced amino acid sequence of recombinant pulchellin A- chain (rPAC) aligned to abrin -a, abrin-c and ricin (RTA) A- chains Conserved amino acids are highlighted...
10 390 0
Báo cáo khoa học: Engineering of a monomeric and low-glycosylated form of human butyrylcholinesterase pdf

Báo cáo khoa học: Engineering of a monomeric and low-glycosylated form of human butyrylcholinesterase pdf

Ngày tải lên : 17/03/2014, 11:20
... kDa molecular mass range In contrast, the puri®ed plasma BChE showed a faint band at 170 kDa (nonreducible dimer) and a major broad band at 85 kDa (monomer) under reducing conditions (Fig 2A) ... was carried out by anion-exchange Ó FEBS 2002 and af®nity chromatography Axelsen et al reported that decamethonium, used during the last af®nity chromatography step of T californica AChE, was ... Lazar, A. , Kronman, C., Barak, D., Ariel, N., Sha€erman, A. , Silman, I & Sussman, J.L (2000) Structures of recombinant native and E202Q mutant human acetylcholinesterase complexed with the snake-venom...
8 472 0
Báo cáo khoa học: Membrane targeting of a folded and cofactor-containing protein potx

Báo cáo khoa học: Membrane targeting of a folded and cofactor-containing protein potx

Ngày tải lên : 23/03/2014, 21:20
... formation of the mutant protein For the in vivo analyses, the RRfiKK exchange was achieved using the primers 5¢-CATCACTTTGACAGCGTCTTTCTTGCTC TTGCTGATTGGCTTATCG-3¢ and 5¢-CGATAAGCCA ATCAGCAAGAGCAAGAAAGACGCTGTCAAAGTG ... dithiothreitol Aggregated material was removed by a final centrifugation at 15 000 g, and the clear supernatant was divided into aliquots and frozen in liquid nitrogen Cofactor tracing and membrane-targeting ... procedure, and time-dependent 55Fe accumulation was monitored The data indicated that only a small amount of 55Fe could be associated with the membrane in the absence of ATP, and addition of ATP enhanced...
11 419 0
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf

Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf

Ngày tải lên : 23/03/2014, 21:20
... dithionite was added gradually to the verdohaem complex under anaerobic conditions, decreases in absorbance at 400, 535 and 690 nm took place and broad bands appeared at 431 and 795 nm (Fig 4A, spectrum ... 2A, a slight decrease in absorbance between 300 and 600 nm (compare spectra a and b) was probably due to the precipitation of free a- hydroxyhaem These observations indicated that a- hydroxyhaem ... Reactions of oxophlorines and their, p radicals J Am Chem Soc 97, 7141–7152 29 Omata, Y., Asada, S., Sakamoto, H., Fukuyama, K & Noguchi, M (1998) Crystallization and preliminary X-ray diffraction...
9 501 0
báo cáo hóa học: " Comparison of the discriminative ability of a generic and a condition-specific OHRQoL measure in adolescents with and without normative need for orthodontic treatment" potx

báo cáo hóa học: " Comparison of the discriminative ability of a generic and a condition-specific OHRQoL measure in adolescents with and without normative need for orthodontic treatment" potx

Ngày tải lên : 18/06/2014, 19:20
... individuals who have a DHC grade of or 5, or grade with an AC of or above All other cases were therefore classified as having no need For DAI, 10 occlusal traits were assessed and a score was obtained ... that affect dental appearance and have an impact on participants' daily lives may not be captured by IOTN In addition, DAI has many more measures of malocclusion affecting the anterior teeth than ... eruption, defects of cleft lip and palate as well as any craniofacial anomaly, Class II and Class III buccal occlusions, and hypodontia Only the highest scoring trait is used to assess treatment need...
6 594 0
báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc

báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc

Ngày tải lên : 18/06/2014, 22:20
... Table 3: Mean item-total correlation and Cronbach's alpha for domain scores in the NFAS-4 and the NFAS-5 (N = 3325) Cronbach's alphaa NFAS-4 NFAS-5 Mean item-total correlation NFAS-4 NFAS-5 Walking/standing ... Table 2: Missing data, means and end effects for NFAS-4 and NFAS-5 items (N = 3325) Missing % NFAS-4 NFAS-5 Walking/standing Standing Walking less than a kilometre on flat ground Walking than ... Mann Whitney U-test Data quality The response rates and the low levels of missing data show that both versions of the NFAS are acceptable to the population A few items had a high percentage of...
9 489 0
Báo cáo hóa học: " Closing two doors of viral entry: Intramolecular combination of a coreceptor- and fusion inhibitor of HIV-1" docx

Báo cáo hóa học: " Closing two doors of viral entry: Intramolecular combination of a coreceptor- and fusion inhibitor of HIV-1" docx

Ngày tải lên : 20/06/2014, 01:20
... coefficient calculated on the basis of the amino acid sequence The purity and the proper tetramer formation of mAbs and mAb-FIs were analyzed by SDS-PAGE in the presence and absence of a reducing agent ... Stuttgart, Germany) The integrity of the amino acid backbone of reduced mAb and mAb-FI light and heavy chains were verified by NanoElectrospray QTOF mass spectrometry after removal of N-glycans ... NNTTWEAWDRAIAEYAARIEALIRAAQEQQEKNEAALREL B performed BFFI and CCR5mAb had very similar binding affinity to human CCR5, suggesting that addition of the FI did not alter the binding affinity of the...
10 341 0
Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx

Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx

Ngày tải lên : 20/06/2014, 22:20
... 0021-9045(88)90006-8 Shah, WM: A generalization of a theorem of Paul Turan J Ramanujan Math Soc 1, 67–72 (1996) Aziz, A, Rather, NA: A refinement of a theorem of Paul Turan concerning polynomials Math Ineq Appl ... http://www.journalofinequalitiesandapplications.com/content/2011/1/111 Page of The above lemma is due to Chan and Malik [11] Lemma 2.4 If p(z) is a polynomial of degree n, having all zeros in the ... Cite this article as: Zireh: On the maximum modulus of a polynomial and its polar derivative Journal of Inequalities and Applications 2011 2011:111 Submit your manuscript to a journal and benefit...
9 423 0
Báo cáo hóa học: "Research Article Design of a Versatile and Low Cost μVolt Level A to D Conversion System for Use in Medical Instrumentation Applicatio" pdf

Báo cáo hóa học: "Research Article Design of a Versatile and Low Cost μVolt Level A to D Conversion System for Use in Medical Instrumentation Applicatio" pdf

Ngày tải lên : 22/06/2014, 01:20
... total circuit and incidental noise is random with a worstcase peak to peak spread of 3.87 mV As the negative and positive excursions are relatively uniform about a mean, EURASIP Journal on Advances ... the case of a hand-held instrument, allows for a “snapshot” of the data stream to be made manually at a time chosen by the operator Use of this additional facility does not interrupt the data stream ... environmental EMR and internal circuit generated noise and furnishes a compact and low cost method for the capture and integrated digital processing of measurement data in a range of situations including...
6 391 0
Step by Step Drawing of a Simple and Funny Cartoon Monkey ppt

Step by Step Drawing of a Simple and Funny Cartoon Monkey ppt

Ngày tải lên : 28/06/2014, 18:20
... Draw another larger circle that overlaps part of the head circle Add two half circles to the sides of the head to make ears Add an oval to the middle-lower part of the head to show the mouth area ... area Add two little eyes above the oval Step - Body & Arms Draw two long skinny rectangles to form the arms At the eng of the arms draw an egg shape to make the form of the hands When drawing a ... drawing a surface to stand on You can this either by adding a line under the feet of the character, or by drawing a shadow underneath him This places your character 'somewhere' rather than having it...
5 319 0
Báo cáo toán học: "Maximum Multiplicity of a Root of the Matching Polynomial of a Tree and Minimum Path Cover" pdf

Báo cáo toán học: "Maximum Multiplicity of a Root of the Matching Polynomial of a Tree and Minimum Path Cover" pdf

Ngày tải lên : 07/08/2014, 21:21
... journal of combinatorics 16 (2009), #R81 For any root θ of µ(G, x), it was shown by Neumaier [6, Corollary 3.3] that the analogue of Gallai’s Lemma holds when G is a tree A different proof was given ... , x) and µ(Pn−1, x) have a common root, say θ Then µ(Pn−1 , x) and µ(Pn−2 , x) have no common root First we show that θ = Note that for any graph G, the multiplicity of as a root of its matching ... the idea of the proof of Theorem 5.3 in [3], we shall prove the Stability Lemma for trees with any given root of its matching poynomial Note that the Stability Lemma is a weaker statement than Theorem...
12 287 0
Báo cáo toán học: "Automorphism groups of a graph and a vertex-deleted subgraph" pot

Báo cáo toán học: "Automorphism groups of a graph and a vertex-deleted subgraph" pot

Ngày tải lên : 08/08/2014, 12:22
... Stephen G Hartke and A. J Radcliffe Mckay’s canonical graph labeling algorithm In Communicating Mathematics, volume 479 of Contemporary Mathematics, pages 99–111 American Mathematical Society, ... reconstruction In Handbook a o of combinatorics, Vol 1, 2, pages 1447–1540 Elsevier, Amsterdam, 1995 [Bol01] B´la Bollob´s Random graphs, volume 73 of Cambridge Studies in Advanced e a Mathematics Cambridge ... there exists a graph G and edge e ∈ E(G) so that Aut(G) ∼ Γ1 and Aut(G − e) ∼ Γ2 If a specific graph G = = ∼ Γ1 and Aut(G − x) ∼ Γ2 , the deletion relation may be and subobject x give Aut(G) = =...
8 268 0
báo cáo khoa học: "Colonic perforation resulting from ingested chicken bone revealing previously undiagnosed colonic adenocarcinoma: report of a case and review of literature" ppt

báo cáo khoa học: "Colonic perforation resulting from ingested chicken bone revealing previously undiagnosed colonic adenocarcinoma: report of a case and review of literature" ppt

Ngày tải lên : 09/08/2014, 01:24
... Pathology and Laboratory Medicine, University of Kansas Medical Center, Kansas City, Kansas, USA 2Pathology and Laboratory Medicine Service, Veterans Affairs Medical Center, Kansas City, Missouri, USA ... The authors thank Mr Dennis Friesen for photographic assistance, Ms Peggy Knaus for secretarial assistance, and Ms Inga Barringer for translation assistance Author details Department of Pathology ... segmental resection Authors’ information Douglas H McGregor is Professor of Pathology at the University of Kansas Medical Center and Director of Surgical Pathology at the Kansas City Veterans Affairs...
4 309 0
báo cáo khoa học: "Metastatic eccrine porocarcinoma: report of a case and review of the literature" pptx

báo cáo khoa học: "Metastatic eccrine porocarcinoma: report of a case and review of the literature" pptx

Ngày tải lên : 09/08/2014, 01:24
... Arapakis I, Kayser G, et al: Eccrine porocarcinoma of the ear mimicking basaloid squamous cell carcinoma Otolaryngol Head Neck Surg 2006, 135:158-160 Shiohara J, Koga H, Uhara H, Takata M, Saida ... porocarcinoma (malignant eccrine poroma): a clinicopathologic study of 69 cases Am J Surg Pathol 2001, 25:710-720 McMichael AJ, Gay J: Malignant eccrine poroma in an elderly AfricanAmerican woman ... from a preexisting lesion as degenerative progression, and it can manifest clinically as a solitary lesion with non characteristic macroscopic appearance, as an ulcerated nodule or as a plaque,...
4 404 0
Báo cáo khoa học: "Malignant inguinal monophasic synovial sarcoma: report of a case and review of the literature" potx

Báo cáo khoa học: "Malignant inguinal monophasic synovial sarcoma: report of a case and review of the literature" potx

Ngày tải lên : 09/08/2014, 03:23
... Wada T, Ida K, Sato Y, Nagoya S, Tsukahara T, Kimura S, Sahara H, Ikeda H, Shimozawa K, Asanuma H, Torigoe T, Hiraga H, Ishii T, Tatezaki SI, Sato N, Yamashita T: Phase I vaccination trial of ... Berean KW: Intraneural biphasic synovial sarcoma: an alternative “glandular” tumor of peripheral nerve Mod Pathol 1996, 9:738-741 Page of 18 Naito N, Ozaki T, Kunisada T, Kawai A, Dan’ura T, ... in patients with disseminated synovial sarcoma J Transl Med 2005, 3:1-9 27 Ishibe T, Nakayama T, Aoyama T, Nakamura T, Toguchida J: Neuronal differentiation of synovial sarcoma and its therapeutic...
4 394 0
Báo cáo khoa học: "Extra-gastrointestinal stromal tumor of the greater omentum: report of a case and review of the literature" potx

Báo cáo khoa học: "Extra-gastrointestinal stromal tumor of the greater omentum: report of a case and review of the literature" potx

Ngày tải lên : 09/08/2014, 07:21
... unavailability at our institute The patient had a regular hospital stay and was discharged eight days later An abdominal CT showed no recurrence of disease 20 months after surgery Page of (page ... Karamanoglu Z: Primary stromal tumor of the omentum: report of a case Surg Today 2006, 36:994-996 Todoroki T, Sano T, Sakurai S, Segawa A, Saitoh T, Fujikawa K, Yamada S, Hirahara N, Tsushima ... 51:524-531 Sakurai S, Fukasawa T, Chong JM, Tanaka A, Fukayama M: Embryonic form of smooth muscle myosin heavy chain (SMemb/ MHC-B) ingastrointestinal stromal tumor and interstitial cells of Cajal Am...
5 365 0
Báo cáo khoa học: "High grade B-cell gastric lymphoma with complete pathologic remission after eradication of helicobacter pylori infection: Report of a case and review of the literature" pdf

Báo cáo khoa học: "High grade B-cell gastric lymphoma with complete pathologic remission after eradication of helicobacter pylori infection: Report of a case and review of the literature" pdf

Ngày tải lên : 09/08/2014, 07:21
... after Helicobacter pylori eradication have a common genetic pattern and if cases without areas of MALT lymphoma are transformed lymphomas or de novo lymphomas The gold standard of treatment of ... antiretroviral therapy (stavudine, lamivudine and indinavir) Both patients obtained, almost initially, a complete remission The median time to remission of lymphoma, calculated on data available from ... et al., [7] and Hiyama et al., [16] are a well defined subgroup characterized by clinical stage E I and presence of areas of MALT lymphoma; clinical stage is not clear in patients with high grade...
7 373 0

Xem thêm