adipose stem cells use as a treatment strategy for obesity

... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... metal dyshomeostasis in all aspects is clear In the AD affected brain, metal dyshomeostasis is evident in the form of a substantial increase in the levels of extracellular metals and a decrease...

Ngày tải lên: 07/03/2014, 10:20

... likely to opt in favor of psychotherapy This identifies a need for augmenting awareness about psychiatric treatment options available in Pakistan as well as for ascertaining the reliability of the ... Declaration A verbal informed consent was taken from all the participants A structured questionnaire was developed in 'Urdu' (national language of Pakistan) after a thorough review of literature ... across age, gender, education and occupational status are elaborated in Additional file The majority supported the use of psychotherapy as an adjuvant to pharmacotherapy (80.5%) and considered it a...

Ngày tải lên: 11/08/2014, 17:20

... plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; ... the E plasmid was 5'-ATCCAAGACGGAATTCCTAGAACTCGTTTTCCTGATTCTGGAG-3' and the 3' primer used for the U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified ... essential for Vif function J Biol Chem 2005, 280(19):18573-18578 Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T, Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H, Iwai K, Uchiyama...

Ngày tải lên: 13/08/2014, 05:21

... Laboratories, PA, USA) The following primers were used: HSVtk, 5'-CCCATATCGGGGACACGTTATTT3' (forward) and 5'-GATAAAGACGTGCATGGAACGGAG-3' 5'-CCTGGATGCCGAACAAGGTTTA-3' (forward) CCAGCGTTCAATGCCTTCAAAC-3' TGGTGTTCCTATTGGCGGATGTCT ... GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG -3’ (forward) and 5’- CCGCTCGAGCTACTCACCAATATCTTCA -3’ (reverse), ... trials for genetic diseases such as sickle cell, β-thalassemia and multiple sclerosis (Trounson A et al., 2011) Autologous adipose stem cells and the stromal vascular fractions are being used for...

Ngày tải lên: 09/09/2015, 18:56

... Arthritis Research Vol No Horwitz et al can serve as a therapy for autoimmune diseases such as systemic lupus erythematosus (SLE) This T-cell-based therapy could also be used to prevent graft ... participation of T cells in natural self-tolerance; deficit of a T cell subset as a possible cause of autoimmune disease J Exp Med 1985, 161:72-87 Kuniyasu Y, Takahashi T, Itoh M, Shimizu J, Toda G, ... in autoimmune diseases characterized by a relapsing and remitting course such as SLE, inflammatory bowel disease or certain forms of multiple sclerosis The adoptive transfer of regulatory T cells...

Ngày tải lên: 09/08/2014, 03:24

... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 ... Control base media Control base media + DMSO Treatment Treatment Treatment Treatment Treatment Treatment Treatment Treatment Day0 + - Day2 + + - Purmorphamine treatment Day4 Day6 Day8 Day10 + + ... lines for hours following ISO 10993 standards DMSO was used as control MTS assay is a standard laboratory colorimetric assay that measures the activity of mitochondrial activity Enzyme reductase...

Ngày tải lên: 16/10/2015, 15:38

... Piedras Feria 142 The creative economy and the development possibilities in Argentina Facundo Solanas 160 Creative economy as a strategy for Jamaica and the Caribbean growth and wealth generation ... urban socioeconomic set, based on local specifics, such as Guaramiranga, with its Jazz and Blues Festival, and Paraty, with FLIP (the International Literary Festival of Paraty) as examples (read ... it has not been established as a second language; c) skilled human resources; d) communications infrastructure in large areas of Africa, of developing Asia, and of several countries in Latin America,...

Ngày tải lên: 14/02/2014, 08:20

... in an Administrative Science Quarterly article titled 'Qualitative data as an attractive nuisance' that research based upon case study was unlikely to transcend story-telling Is case study a valid ... has summarized major criticisms An epistemological base for analyzing the value of case study research programmes has been ruled out as a major threat because of inconsistencies in the application ... adamant that a case database be created and maintained to \allow repetition and re-evaluation of cases Reliability is most important during the data collection phase, and involves the use of case study...

Ngày tải lên: 20/02/2014, 11:20

... the early trophoblast of the attachment phase or as later invasive stage [46–48] Thus, in most cases, choriocarcinoma has the appearance of trophoblast, being predominantly syncytiotrophoblastic ... cell association was calculated as the difference between total and nonspecific cell association In a parallel set of experiments, the cell association of [3H]CE-HDL3 by choriocarcinoma cells was ... was aspirated and the cells were rinsed as described above [34] Degradation of 125I-labeled HDL3 by choriocarcinoma cells was estimated by measuring the nontrichloroacetic acid-precipitable radioactivity...

Ngày tải lên: 20/02/2014, 23:20

... use [17] Statistical software and significance levels Rasch analysis was undertaken using the RUMM2020 package [18] During the Rasch analysis, Bonferroni corrections are applied to both fit and ... clear DIF with the older least educated group having a much lower probability of passing, at any given level of cognitive ability, than all other ages and educational levels (age and education are ... 75.0 62.5 75.0 sample meant that group sizes at the level of age and educational group were similar Although we used parametric ANOVA where perhaps a non-parametric approach would have been more...

Ngày tải lên: 20/06/2014, 15:20

... Cu release was clearly demonstrated and release was accelerated as the pH was reduced In vitro toxicity of CuCNPs in HeLa cells The toxicity of CuCNPs to cancer cells was investigated and results ... disease states including cancer, cardiovascular disease, arthritis, diabetes, Alzheimer’s disease, and Parkinson’s disease [27] Cancer cells use ROS to suppress apoptosis, accelerate proliferation, ... Oxide and Cerium Oxide Nanoparticles Based on Dissolution and Oxidative Stress Properties ACS Nano 2008, 2:2121-2134 Ahamed M, Akhtar MJ, Siddiqui MA, Ahmad J, Musarrat J, Al-Khedhairy AA, AlSalhi...

Ngày tải lên: 21/06/2014, 02:20

... waste was applied before planting as was 50 % of the inorganic P and K The remaining P and K was applied at panicle initiation stage at 35 days after sowing (DAS) while N was split times (7, 20 and ... (Page et al 1982), plant analysis (Chapman and Pratt, 1961); water and wastes samples analysis followed methods for chemical analysis of water and wastes (MCAWW) EPA/600/4/79-020 revised March ... Statistical analysis was completed with IRRISTAT software version 5.1 by applying a balanced one-way ANOVA Nutrient (N, P, K) balances were calculated following the approach of Dobermann and Fairhurst...

Ngày tải lên: 21/06/2014, 04:20

... tsom si ydalam siht dna sulahpecordyh latinegnoc ot desopsiderp era sauhauhihC aixata htiw detneserp saw muiravlac depahs-emod a htiw god auhauhihC a ,esac siht nI ]3[ erusserp lainarcartni eht ... noitamroflam I iraihC taht detroper evah srepap emoS esac siht ni sredrosid lacinilc eht ot etubirtnoc ton did aileymognirys dna noitamroflam I iraihC taht dna sulahapecordyh fo tluser a ylniam saw aixata ... tcudeuqa cilahpecnesem deworran a evlovni sulahpecordyh latinegnoc fo sesac rehtO etar etauqeda na ta FSC brosbaer ot illiv dionhcara eht fo eruliaf ot eud yltnerappa giF si sulahpecordyh )latinegnoc(...

Ngày tải lên: 07/08/2014, 18:21

... Cry41Aa (parasporin-3) and Cry45Aa (parasporin-4) also with selective cytotoxic activities against cancer cells [5-7] Recently two more parasporin (PS5Aa1 and PS6Aa1) were added in the parasporin ... Kitada S, Abe Y, Shimada H, Kusaka Y, Matsuo Y, Katayama H, Okumura S, Akao T, Mizuki E, Kuge O, Sasaguri Y, Ohba M, Ito A: Cytocidal Actions of Parasporin-2, an Anti-tumor Crystal Toxin from Bacillus ... cell-killing activity is associated with some non-insecticidal Bt isolates resulting in a new category of Bt parasporal protein called parasporin Parasporins are defined as bacterial parasporal proteins...

Ngày tải lên: 10/08/2014, 05:21

... OPCAB has not been as convincing as primarily anticipated [3] Technically, OPCAB revascularisation can be very demanding, particularly when marginal branches need to be revascularized which may ... Giammarco G, Pano M, Vitolla G, Bivona A, Carella R, D'Alessandro S Myocardial revascularization with and without cardiopulmonary bypass in multivessel disease: impact of the strategy on early ... quality of graft anastomoses As a consequence, multiple efforts were taken to achieve the same advantages with modified cardiopulmonary bypass systems as can be achieved with OPCAB -10- approaches The...

Ngày tải lên: 10/08/2014, 09:22

... stimulator in a patient with TCS as an effective treatment for refractory chronic neuropathic pain has not been described Page of previously Despite the anatomical abnormality of the spinal cord ... intra-operative anesthesia through the epidural catheter without any meningeal puncture [12] With this type of anesthesia patients can feel paresthesias during intra-operative stimulation because ... electrical nerve stimulation (TENS) partly diminished her pain Subsequently, a spinal cord stimulator (SCS) was surgically placed when our patient was under epidural anesthesia An epidural catheter...

Ngày tải lên: 11/08/2014, 11:23

... issue are warranted Competing interests The author(s) declare that they have no competing interests References 532 Villa P, Jiménez M, Soriano MC, Manzanares J, Casasnovas P: Serum cystatin C as a ... filtration rate in renal transplant recipients Clin Chem 1999, 49:1866-1868 Coll E, Botey A, Alvarez L, Poch E, Quintó LI, Taurina A, Vera M, Piera C, Darnell A: Serum cystatin C as a new marker for ... as a marker of acute renal dysfunction in critically ill patients Crit Care 2005, 9:R139-R143 O’Riordan SE, Webb MC, Stowe HJ, Simpson DE, Kandarpa M, Coakly AJ, Newman DJ, Saunders JA, Lamb EJ:...

Ngày tải lên: 12/08/2014, 22:21

... source for MSC, because adipose stem or stromal cells (ASC) can be readily isolated in considerably larger amounts.6 As mesenchymal stem cells, BMSC and ASC share many biological characteristics, and ... Transmigration Rate (% total) A a ab b NC b vehicle PPK ASC TSG6 Thrombin D ab Transmigration Rate (% total) Transmigration Rate (% total) C ab a a b NC vehicle PPK a a a a NC vehicle PPK CMA ... human ASC and murine host inflammatory signals was described, and specifically TSG-6 was identified as a necessary and sufficient mediator accounting for the activity of the ASC secretome to ameliorate...

Ngày tải lên: 24/08/2014, 11:56

... certain tumour types like leukaemia have little ASSN activity and require exogenous asparagine This has led to the use of asparaginase, the enzyme that converts asparagine to aspartate and ammonia, ... diphosphate ; ALD, aldolase ; ALT, alanine aminotransferase; ATP, adenosine triphosphate; CS, citrate synthase; ENO, enolase; FA, fatty acids; FAD, flavin adenine dinucleotide; FASN, fatty acid synthase; ... ALD, aldolase ALT, alanine transaminase AKT, protein kinase B AML, acute myeloid leukemia AMP, adenosine monophosphate AMPK, AMP activated protein kinase ASCT, amino acid transporter ATP, adenosine...

Ngày tải lên: 22/12/2014, 20:36

... same as experiment Statistical analysis Data for all measured parameters were analyzed using Excel, and SPSS for Windows, Version 18.0 Variations from dietary treatment were compared by one way ANOVA ... world Tilapia production were Nile Tilapia Production of Tilapia in Vietnam has been increasing year by year; the farming area has been expanded In 2009, the area of tilapia reached 29,717 ha, production ... values are in the range for normal growth of Tilapia 4.3.2 Survival and Growth performance Survival of Tilapia was not affected by the feeding treatments; all treatments had 100% survival (Table...

Ngày tải lên: 18/11/2015, 19:54