adipose stem cells as a valuable target for research

... Laboratories, PA, USA) The following primers were used: HSVtk, 5'-CCCATATCGGGGACACGTTATTT3' (forward) and 5'-GATAAAGACGTGCATGGAACGGAG-3' 5'-CCTGGATGCCGAACAAGGTTTA-3' (forward) CCAGCGTTCAATGCCTTCAAAC-3' TGGTGTTCCTATTGGCGGATGTCT ... GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG -3’ (forward) and 5’- CCGCTCGAGCTACTCACCAATATCTTCA -3’ (reverse), ... trials for genetic diseases such as sickle cell, β-thalassemia and multiple sclerosis (Trounson A et al., 2011) Autologous adipose stem cells and the stromal vascular fractions are being used for...

Ngày tải lên: 09/09/2015, 18:56

... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 ... lines for hours following ISO 10993 standards DMSO was used as control MTS assay is a standard laboratory colorimetric assay that measures the activity of mitochondrial activity Enzyme reductase ... functional assays as a standard of hESCs as a model for drug discovery 29 One of the major areas of stem cell differentiation research is the derivation of osteolineage for bone tissue engineering and...

Ngày tải lên: 16/10/2015, 15:38

... transplantation of cartilage In vivo analysis in rabbits repair by synovial mesenchymal stem cell transplantation in rabbits (a) Cell transplantation on a cartilage defect in a rabbit by the local adherent ... was measured Data expressed as the mean ± standard deviation (n = 3; P < 0.05 by Kruskal–Wallis test) ALCAM, activated leukocyte-cell adhesion molecule Available online http://arthritis -research. com/content/10/4/R84 ... increasing the safety and economic feasibility Our study will advance and extend the clinical application of MSC-based cell therapy for cartilage injury Materials and methods Rabbits Skeletally mature...

Ngày tải lên: 09/08/2014, 10:23

... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Pediatr Res 2000, 48:6-11 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of immunodeficiency in a patient ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic...

Ngày tải lên: 18/06/2014, 16:20

... the US National Institutes of Health is in the planning stage 132 Although autoantibodies in autoimmune cytopenias and some other diseases, such as pemphigus and myasthenia gravis, have a direct ... immunoglobulin levels are usually maintained, possibly as a consequence of plasma cells being spared B-cell depletion in antibody-mediated diseases It is understandable that rituximab has been most frequently ... in autoimmunity are available from patients with RA Initially, Edwards and Cambridge reported on five patients with refractory RA, all of whom had major improvement in disease activity and achieved...

Ngày tải lên: 09/08/2014, 01:21

... associated with human asthma), suggesting biological effects on granulocytes [47] Mast cells are also important effector cells in asthma, and increased numbers of intra-epithelial lung mast cells ... indicating a role for IL-13 as a general enhancing factor on TH2 response Respiratory Research Vol No Zhou et al 31 Daniels SE, Bhattacharrya S, James A, Leaves NI, Young A, Hill MR, Faux JA, Ryan GF, ... R, Arima K, Arinobu Y, Yu B, Kruse S, Enomoto T, Dake Y, Kawai M, Shimazu S, Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa...

Ngày tải lên: 12/08/2014, 18:20

... vacuolar formations Cavitation of the gray matter was seen within cranial and caudal lesions of the SCI site Vacuolar formations and cavitation acted as a physical barrier to the growth of anatomically ... dexamethasone (Sigma-Aldrich, USA), 50 μM l-Ascorbate2-phosphate (Sigma-Aldrich, USA), and 10 mM betaglycerophosphate (Sigma-Aldrich, USA)] for weeks [14] Mineralization was assessed by staining ... expressed as medians for Olby scores and the means ± SD for SEP values and Luxol fast blue positive areas Statistical analysis used SPSS 12.0 software (SPSS, USA) Kruskal-Wallis analysis for Olby...

Ngày tải lên: 07/08/2014, 23:22

... mammalian DNA are methylated; however, even after complete demethylation, mammalian DNA is still poorly stimulatory • Inefficient uptake: uptake of mammalian DNA into immune cells mediated via ... follicular B cells) , we now classify INH-ODN into two categories: class B (broadly reactive) and class R (restricted reactivity) We therefore see a possible therapeutic role for class R INH-ODNs as a ... secondary to cellular activation [116] Interestingly, medications that can cause drug-induced lupus (e.g hydralazine and procainamide) are capable of blocking methyltransferase activity [117], and...

Ngày tải lên: 09/08/2014, 07:20

... Cry41Aa (parasporin-3) and Cry45Aa (parasporin-4) also with selective cytotoxic activities against cancer cells [5-7] Recently two more parasporin (PS5Aa1 and PS6Aa1) were added in the parasporin ... Kitada S, Abe Y, Shimada H, Kusaka Y, Matsuo Y, Katayama H, Okumura S, Akao T, Mizuki E, Kuge O, Sasaguri Y, Ohba M, Ito A: Cytocidal Actions of Parasporin-2, an Anti-tumor Crystal Toxin from Bacillus ... cell-killing activity is associated with some non-insecticidal Bt isolates resulting in a new category of Bt parasporal protein called parasporin Parasporins are defined as bacterial parasporal proteins...

Ngày tải lên: 10/08/2014, 05:21

... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... that incorporates the significant physical processes and the key parameters affecting fuel cell performance The model accounts for both gas and liquid phase in the same computational domain, and ... reduces to Darcy’s law, which is, however, based on the relative permeability for the gas phase (KP ) The relative permeability accounts for the reduction in pore space available for one phase due...

Ngày tải lên: 05/09/2013, 14:58

... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital ... endo-glucanase, exo-glucanase and β-glucosidase Endo-and exo-glucanases are commonly referred to as “cellulases” Fungal strains of Trichoderma reesei are used to produce most commercial cellulase...

Ngày tải lên: 05/09/2013, 15:28

... 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the EcoRV site of pBluescript SK(+) (Stratagene, La Jolla, CA, USA) and sequenced using an automated ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon for ... 5¢-AA GCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATC CAAGAACTGTGTATGTCTG-3¢ The 1.6-kbp fulllength Skn cDNA, whose termination codon was changed to a BamHI site, was inserted between the SalI and the BamHI...

Ngày tải lên: 18/02/2014, 16:20

... recovered as described above was mixed with pre-equilibrated Ni ⁄ nitrilotriacetate ⁄ agarose (Qiagen, Valencia, CA, USA), and rocked at °C for h The lysate ⁄ Ni ⁄ nitrilotriacetate bead mixture was ... not affect basal PLD1 activity or PMA-stimulated PLD1 activation, but completely ablated stimulation of PLD1 by H2O2 This shows that PrxII can function as a negative regulator of PLD1 activation ... that PLD1 can be found at the plasma membrane of COS-7 cells h after the initiation of PMA stimulation, and that the translocation is facilitated by PLD1 activation [23] In this study, we searched...

Ngày tải lên: 20/02/2014, 01:20

... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7A ... that increasing CO2 concentration of up to 1% of air will increase lipid produced by algae was given in Table As shown in this table, cell concentration obtained after 20 days incubation was ... 48 MAKARA, TEKNOLOGI, VOL 13, NO 1, APRIL 2009: 47-51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of...

Ngày tải lên: 21/02/2014, 10:20

... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-1 7A ... that increasing CO2 concentration of up to 1% of air will increase lipid produced by algae was given in Table As shown in this table, cell concentration obtained after 20 days incubation was ... 48 MAKARA, TEKNOLOGI, VOL 13, NO 1, APRIL 2009: 47-51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of...

Ngày tải lên: 21/02/2014, 10:20

... PKH leads inter alia to a decreased availability of PLP for GAD, which catalyses the formation of c-aminobutyric acid, the most potent inhibitory neurotransmitter in the mammalian brain Decreased ... membrane-bound phosphatases (Fig 2A) [13,14] Inside the brain a rephosphorylation to PLP takes place, again catalysed by pyridoxal kinase (Fig 2A) [7,14] As a consequence, there is a requirement for ... systems were employed: an HPLC assay and an optical test, in which phosphorylation of pyridoxal was measured (see Experimental procedures) The kinetic data given in Table reveal that among all...

Ngày tải lên: 07/03/2014, 10:20

... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... metal dyshomeostasis in all aspects is clear In the AD affected brain, metal dyshomeostasis is evident in the form of a substantial increase in the levels of extracellular metals and a decrease...

Ngày tải lên: 07/03/2014, 10:20

... was stored at ) 80 °C for analysis for metals Paraffin sections lm thick were prepared and stained with hematoxylin and eosin The gonadal maturity of each animal was classified into five stages according ... substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The normality ... using a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) with bovine c-globulin as a standard Thyroglobulin (669 kDa), catalase (232 kDa), BSA (67 kDa) and chymotrypsinogen (25 kDa) were used for...

Ngày tải lên: 16/03/2014, 05:20

... peptide-antibody recognition 11 Murata T, Fushinobu S, Nakajima M, Asami O, Sassa T, Wakagi T & Yamaguchi I (2002) Crystal structure of the liganded anti-gibberellin A4 antibody 4-B8(8) ⁄ E9 Fab fragment ... restraints, and eight dihedral angle restraints Fifty conformations that give low conformation energy and that give no distance and dihedral angle violations greater than ˚ ˚ 0.5 A and A, respectively, ... stage, the same protocol was applied by adding hydrogen bond restraints and dihedral angle restraints Additional NOE constraints were added in each round of calculations, and restraints that...

Ngày tải lên: 16/03/2014, 23:20

... lexical information encoded in (1) The question that arises is how to relate DATR and PATR so that the hierarchically structured lexical information in DATR can be made available in PATR-usable ... Queries that the grammar writer has stated explicitly have to be passed on to DATR Every query together with the resulthag value has to be transformed into a PATR path equation (that partially describes ... OF DATR DATR (described in detail by Evans/ Gazdar, 198 9a; 1989b; 1990)is a declarative language for the definition of semantic networks which allows for defaults as well as multiple inheritance...

Ngày tải lên: 18/03/2014, 02:20