adiabatic one dimensional steady state flow of an incompressible fluid through a nozzle
Báo cáo y học: " Investigation of the cerebral blood flow of an Omani man with supposed ‘spirit possession’ associated with an altered mental state : a case report" docx
Ngày tải lên :
11/08/2014, 14:21
... history of a recent change in personality and impairment of sensory perception The patient complained of abnormal auditory experiences when alone He also complained that the appearance of his father ... Authors' contributions AAG, AH and YAO were the physicians responsible for the care of the patient SH and FA were involved in executing and analyzing neuro-imaging data SA reviewed the relevant ... Journal of Medical Case Reports 2009, 3:9325 ogy, as exemplified by both the Diagnostic and Statistical Manual of Mental Disorders and the International Classification of Diseases [3] In traditional...
- 5
- 331
- 0
Tài liệu Steady State Operation of DC Machines pptx
Ngày tải lên :
17/12/2013, 14:15
... and equal to rated Mechanical losses and iron core losses can be neglected and armature voltage is constant and equal to rated Calculate rated torque and rated power of the machine whose data ... of a DC motor Standard data that are given for a DC motor on its nameplate are so-called rated values of output power, armature voltage and current, excitation voltage and current, and speed of ... the two calculated points Solution: Note that parts a) and b) are the ‘exam’ version of the Example 1, with minor changes and additions! a) As rated voltage and rated armature current are known,...
- 12
- 527
- 1
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx
Ngày tải lên :
21/02/2014, 15:20
... [10], yeast [11] and mammalian [12,13] enzymes that all require the presence of UTP and/or ATP to form tetramers Therefore, the L lactis CTP synthase is an attractive candidate for mechanistic and ... 4-phosphorylated UTP intermediate in a mechanism as that of Scheme 1A From Fig and Table it can be seen that the effect of saturating the active site with ATP-cS and UTP was a relief of partial inhibition ... in Table 1, and those obtained for the glutaminase reaction in the presence of 0.1 mM each of UTP and ATP-cS (data not shown) Apparently, the value of Ka, kcat,1 and kcat,2 were similar regardless...
- 8
- 698
- 0
Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx
Ngày tải lên :
29/03/2014, 09:20
... 100 KlGal4pt (μM) 101 Fig (A) Time course of fractional b-galactosidase expression in a mutant strain lacking KlGAL80 A typical fed-batch operation aimed at maintaining an average steady- state glucose ... the GAL systems of K lactis and S cerevisiae are as follows: (a) the autoregulation of transcriptional activator KlGal4p; (b) the dual role of KlGal1p as a metabolizing enzyme as well as a galactose-sensing ... FEBS V R Pannala et al were tabulated as the steady- state fractional protein expressed at different average steady- state glucose ⁄ galactose concentrations Substrate and enzyme activity measurements...
- 16
- 371
- 0
Báo cáo khoa học: Analysis of the contribution of changes in mRNA stability to the changes in steady-state levels of cyclin mRNA in the mammalian cell cycle doc
Ngày tải lên :
30/03/2014, 20:20
... CCAACCACTATATTACACCAATGATGGAGCTGAA 700 700 100 Forward Reverse Probe CAACAAAGTGGATATTAAAGACAGGAAAG TGGCAGAAATGTCATAGTACTGAAGATT AAGGCAAAATCTATTGTCTTCCACCGGAAGAA 300 700 200 Forward Reverse Probe CTGGATTTCCTTTGGGCGTT ... Probe AAAGGAGATCAAGCCGCACAT GTTCATAGCCAGAGGGAAGACATC CTCCTCACACACCTCCAGCATCCAGTATG 300 500 100 Forward Reverse Probe TCTCCTCACTGGAGTTGATGCA AACGGAACCATCCATTTGACA CTCTATGTCGCACCACTGATAACCTGAGACCTT ... Forward Reverse Probe CCGAAGAGGAGTGGAGGAGACT ATATGCGGTTCTGGCTCATGA CATGTAATGAACCCATCCTAGACTCTGTTGGACA 700 700 150 Forward Reverse Probe TGAGGAGGGACAAAACCTTGAA TCGGTCACTGCCAGCATTC CCAACCACTATATTACACCAATGATGGAGCTGAA...
- 13
- 338
- 0
Báo cáo hóa học: " Procedure for the steady-state verification of modulation-based noise reduction systems in hearing instruments" doc
Ngày tải lên :
20/06/2014, 22:20
... output signal For systems with analog transducers like hearing instruments, the signals x and y have to be interfaced to the system under test via a digital-to-analog and an analog-to-digital converter ... NLMS-based measurement As an improvement of the least mean squares (LMS) algorithm that has been introduced by Widrow and Hoff [14], Nagumo and Noda [15] have introduced the normalized least mean ... should ensure that the stimulus of variable modulation spanned Table Parametrization of measurements Choice of parameter i as a function of subband number b Type of signal lb and νb ∀i: i =...
- 20
- 415
- 0
Báo cáo hóa học: " Optical identification of electronic state levels of an asymmetric InAs/InGaAs/GaAs dot-in-well structure" potx
Ngày tải lên :
21/06/2014, 04:20
... Stiff-Roberts A, Bhattacharya P: Influence of rapid thermal annealing on a 30 stack InAs/ GaAs quantum dot infrared photodetector J Appl Phys 2003, 94:5283 Xu ZY, Lu ZD, Yang XP, Yuan ZL, Zheng ... Ge WK, Wang Y, Chang LL: Carrier relaxation and thermal activation of localized excitons in self-organized InAs multilayers grown on GaAs substrates Phys Rev B 1996, 54:11528 Dai YT, Fan JC, Chen ... carrier transfer from small QDs to large QDs can explain the abnormal temperature dependence (ATD) of PL spectra, i.e., rapid red-shift of peak energy compared to the bulk material and S-shaped...
- 8
- 219
- 0
Báo cáo hóa học: "One-Dimensional Nanostructures and Devices of II–V Group Semiconductors" ppt
Ngày tải lên :
21/06/2014, 20:20
... shows that long and straight nanobelts are obtained on a large scale Each nanobelt has a uniform width of 100–200 nm and length in the range of tens of micrometers A highmagnification SEM image shown ... behavior of Cd3P2 bicrystal nanobelts was also investigated at different temperatures and the results (Fig 8d) also suggested a dominant thermal activation of carriers transport mechanism Nanoscale ... Fig a SEM image of Zn3P2 nanobelts b TEM image and c, d HRTEM images of Cd3P2 nanobelts The clearly resolved lattice fringes perpendicular to and along the longitudinal axis of the nanobelt are...
- 10
- 256
- 0
Báo cáo hóa học: " Research Article Analysis of Transient and Steady-State Behavior of a Multichannel Filtered-x Partial-Error Affine Projection Algorithm" docx
Ngày tải lên :
22/06/2014, 22:20
... (33) and in (34) provide accurate estimates of the steady- state MSE and of the steady- state A Carini and G L Sicuranza Table 3: First eight coefficients of the MMS solution (wo ) and of the asymptotic ... solution of the FX-PE-AP algorithm and compares it with that of FX-AP algorithms and with the minimum-mean-square solution of the ANC problem Section presents the analysis of the transient and steady- state ... (A. 1) CONCLUSION In this paper, we have provided an analysis of the transient and the steady- state behavior of the FX-PE-AP algorithm We have shown that the algorithm in presence of stationary...
- 15
- 311
- 0
Báo cáo khoa học: "Activation domain in P67phox regulates the steady state reduction of FAD in gp91phox" pot
Ngày tải lên :
07/08/2014, 14:22
... hydride/electron transfer reaction Materials and Methods Preparation of plasma membrane, cytochrome b558 and recombinant proteins: Plasma membranes were isolated as described by Burnham et al [4] Further ... measured by adding a few crystals of sodium dithionate To calculate the percent reduction of the FAD analog at steady state, the fluorescence change at 525 nm attributable to NADPH oxidation was ... regulates the steady state reduction of FAD in gp91phox 29 Table Effects of cytosolic factors on NADPH oxidase activity and on the steady state reduction of FAD and heme 8Thioacetamido-FAD was reconstituted...
- 5
- 240
- 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx
Ngày tải lên :
14/02/2014, 03:20
... Figures and 9) The lack of any additional peaks in the XRPD patterns would imply the presence of an Figure DSC of atypical anhydrous Form I (sample 11) amorphous material and/or an impurity Note that ... thermogravimetric analysis (TGA), attenuated total reflectance (ATR) IR and ATR-near-IR),12 methotrexate (along with TGA),13 carbamazepine (along with FTIR and hot-stage FTIR thermomicroscopy),14 ranitidine ... to dynamically characterize the polymorphic behavior of an organic compound API over a temperature range of hundreds of degrees This allows the simultaneous measurements of thermochemical and thermophysical...
- 16
- 549
- 0
Đề tài " Well-posedness for the motion of an incompressible liquid with free surface boundary " docx
Ngày tải lên :
15/03/2014, 09:20
... divergence and derivatives that are tangential at the boundary The second part say that one can get L2 estimates with a normal derivative instead of tangential derivatives The last part says that we can ... we show that any derivative of a vector field can be estimated by derivatives of the curl and of the divergence, and tangential derivatives or tangential derivatives of the normal operator Section ... the fact that any derivative of a vector field can be bounded by tangential derivatives and derivatives of the divergence and the curl; see Section The 130 HANS LINDBLAD divergence vanishes and...
- 87
- 332
- 0
Detection of an uncharged steroid with a silicon nanowire field effect transistor
Ngày tải lên :
16/03/2014, 15:23
... conductance of BS3- and Art KSI-labeled SiNW-FET remained constant on the addition of 19-NA up to 0.3 pM, indicating that the background disturbance of 19-NA is insignificant [Fig 5 (a) ; data for ... the calculated value 13,768 Da (13402 Da for Art KSI and 366 Da for mA51 moiety) (b) The structures of 1,5-EDANS, mA51 moiety and mA51-mA51 a film of SiO2 (thickness 30 nm) and surface modification ... are not shown] Upon addition of 19-NA at various concentrations, the conductance of Art KSI/mA51-labeled SiNW-FET rapidly increased to a constant value [Fig 5(b)] 19-NA at a greater concentration...
- 6
- 492
- 1
Báo cáo lâm nghiệp: "Earthworms (Lumbricidae) of an air-polluted area affected by ameliorative liming" pdf
Ngày tải lên :
07/08/2014, 10:21
... growing season 115–130 days and natural species composition Fagus sylvatica L., Abies alba Mill and Picea abies (L.) Karst Fageto-Piceetum acidophilum (7K) is a typical site of upland locations of the ... Mts (altitude 900–1,050 m) with mean annual temperature 4–4.5°C and total annual precipitation 1,050–1,200 mm, growing season 100–115 days and natural species composition P abies, F sylvatica and ... individuals·m–2) A partial shift according to abundance was indicated towards higher pH in D octaedra (Table 4) The high level of the sorption capacity of soil (T) was dominant Because comparative categories...
- 9
- 409
- 0
Báo cáo lâm nghiệp: "Evolution of the mineral fertility of an acidic soil during a period of ten years in the Vosges mountains (France). Impact of humus mineralisation" pps
Ngày tải lên :
08/08/2014, 00:21
... and Daniel Imbert; to Saïd Belkacem and the INRA laboratory in Arras for mineral soil analyses, to the INRA laboratory in Bordeaux (L.E.R.M .A. V.E.) for organic horizon analyses; to Jacques Ranger ... Hildebrand [9] applied the Gapon cation exchange law to soils rich in exchangeable Al, and showed that, when the exchange complex was very rich in exchangeable Al, it became unable to adsorb Ca and ... mineral weathering) and outputs (immobilisation in biomass, drainage) These data are not usually very accurate, and so a direct measurement of changes in total and exchangeable elements is necessary...
- 8
- 334
- 0
Báo cáo khoa học: "Consequences of an excess Al and a deficiency in Ca and Mg for stomatal functioning and net carbon assimilation of beech leaves" ppt
Ngày tải lên :
08/08/2014, 14:22
... excess Al and a deficiency in Ca and Mg was calculated for +Al–CaMg plants (–70%) The decrease in A was accompanied by a constancy of the calculated sub-stomatal CO2 mole fraction (ci) On a chlorophyll ... remained constant and similar to the value recorded in control dark-adapted leaves, i.e 0.9 3.3 Stomatal response to ABA Stomatal responses to an application of exogenous ABA via the transpiration ... were always recorded in the guard cells, and may result from an accumulation of Al via the transpiration stream +Al and +Al–CaMg plants showed similar Al concentration It should be remember that...
- 10
- 376
- 0
Báo cáo y học: " Psychological distress among patients of an orthopaedic outpatient clinic: a study from a low-income country" docx
Ngày tải lên :
08/08/2014, 23:21
... evidence of an organic disease that could explain Husain et al Annals of General Psychiatry 2010, 9:9 http://www.annals-general-psychiatry.com/content/9/1/9 Page of Table 1: Mean (standard deviation) ... (SPSS, Chicago, IL, USA) In order to assess the variables that were significantly associated with SRQ scores we used analysis of variance (ANOVA) for ordinal variables and Pearson's correlations ... not made aware of any participants who had actually injured themselves deliberately; accidents are more common while Husain et al Annals of General Psychiatry 2010, 9:9 http://www.annals-general-psychiatry.com/content/9/1/9...
- 7
- 278
- 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
Ngày tải lên :
09/08/2014, 06:22
... dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating ... 40:413-418 29 James K, Carpenter AB, Cook L, Marchand R, Nakamura RM: Development of the antinuclear and anticytoplasmic antibody consensus panel by the Association of Medical Laboratory Immunologists ... patients, one from an east Indian patient, and one from an oriental patient The racial background of four patients was not known Of these patients, 13 were male and 86 female (in two the sex was unknown),...
- 11
- 593
- 0
Báo cáo y học: " Spontaneous bleeding of an Abrikossoff''''s tumor - a case report." pps
Ngày tải lên :
10/08/2014, 10:20
... of the manuscript, AW was the initial doctor in charge, CB is the pathologist, BL performed the lobectomy as head of surgical department All authors have read and approved the final version of ... Sutedja TG, Kwa HB, Postmus PE, Wagenaar SS: Granular cell tumors of the tracheobronchial tree J Thorac Cardiovasc Surg 2003, 126(3):740-3 Valenstein SL, Thurer RJ: Granular cell myoblastoma of ... than mm in diameter Bronchoscopical treatment of larger tumors is associated with a significant increase in the recurrence rate In addition, the hemorrhage rate is also increased [12,13] Our patient...
- 3
- 425
- 0