addresses class a b and c

... (Millipore Corporation, Madison, WI, USA) and incubated with rabbit polyclonal antibodies against TEM Goat anti-(rabbit IgG) coupled to alkaline phosphatase (Bio-Rad, Hercules, CA, USA) were added (according ... guanylin receptor of epithelial cells of the calf intestine, the toxin causes fluid accumulation as a < /b> consequence of the activation of guanylate cyclase C and the subsequent accumulation of cGMP ... three-dimensional structure of TEM-1 is well characterized [7–9] Like all class < /b> A < /b> b- lactamases, TEM-1 folds into a < /b> structure formed by an a < /b> ⁄ b- domain and an all -a-< /b> domain (Fig 1A)< /b> At the junction between...

Ngày tải lên: 30/03/2014, 02:20

... with coefficient +1 at c and coefficient at all c ∈ F (P of a < /b> signed partition as (a,< /b> −1) and an unbarred letter as (a,< /b> 1) ¯ To bar a < /b> block b in a < /b> signed partition is to bar all unbarred elements in b and to unbar all barred elements in b We denote ... natural way to associate polytopal cycles in the intersection lattice LA with regions of the arrangement A < /b> These cycles are not necessarily Boolean They are the electronic journal of combinatorics...

Ngày tải lên: 07/08/2014, 08:22

... VO2 (A)< /b> and VO2 (B) .” (Manuscript in preparation) 14 A,< /b> Rana, T Sarkar, S Saha, X Hai, M Motapothula, A < /b> Srivastava, K Gopinadhan, B Kumar, A < /b> Ariando, L Ping and T Venkatesan, “Surface midgap states ... surface parallel to the target surface at a < /b> target-to-substrate distance of typically 2-10 cm to catch the ablated material normal to the target surface Materials YBa Cu O High-temperature superconductors ... 2.6 (a)< /b> Four-circle x-ray diffractometers with the conventional 2D area detector (Bruker AXS, Inc., D8 Discover) and (b) schematic diagram. (c) schematic diagram of symmetric and asymmetric reciprocal...

Ngày tải lên: 09/09/2015, 08:13

Ngày tải lên: 28/11/2013, 21:14

Ngày tải lên: 28/11/2013, 21:19

... of the medaka, Oryzias latipes Proc Natl Acad Sci USA 99, 11778–11783 Matsuda M, Nagahama Y, Shinomiya A,< /b> Sato T, Matsuda C, Kobayashi T, Morrey CE, Shibata N, Asakawa S, Shimizu N et al (2002) ... 47 Wang DS, Zhou LY, Kobayashi T, Matsuda M, Shibata Y, Sakai F & Nagahama Y (2010) Doublesexand Mab-3-related transcription factor-1 repression of aromatase transcription, a < /b> possible mechanism ... nasal and otic placodes, telencephalon, branchial arches During somotogenesis, gills and brain Embryogenesis, brain dmrt5 Paralichthys olivaceus Danio rerio Testis Testis (weak) and ovary (weaker):...

Ngày tải lên: 14/02/2014, 19:20

... et al [41] Acid phosphatase was assayed as described by Trouet [42] Caspase-3, caspase-8 and caspase-9 activity was analyzed with a < /b> fluorometric assay kit (BioVision, Mountain View, CA, USA) with ... Mouse monoclonal antibody directed against rat cytochrome c was purchased from Pharmingen Rabbit polyclonal antibody against human EF-2 and goat polyclonal antibody raised against the C- terminus ... enzyme assays, and materials Pseudomonas aeruginosa ETA, DT and bafilomycin -A1< /b> were purchased from Calbiochem Bovine cathepsin D (EC 3.4.23.5, 15 UÆmg)1), bovine cathepsin B (EC 3.4.22.1, recombinant...

Ngày tải lên: 18/02/2014, 04:20

... 5¢-caa cgagcctagacagatttgctttgagg-3¢; mutation E19 4A,< /b> 5¢-gagagattt gctttgcgggttatggatctgc-3¢; mutation K20 1A,< /b> 5¢-gttatggatctgct accgcggctccgatcctaaacg-3¢; mutation K201F, 5¢-ggttatggatctg ctacttcgctccgatcctaaacgc-3¢; ... NPbxyl MUbglc NPbfuc NPbglc NPbgal NPbxyl MUbglc NPbfuc NPbglc NPbgal NPbxyl MUbglc NPbfuc NPbglc NPbgal NPbxyl MUbglc NPbfuc NPbglc NPbgal NPbxyl MUbglc NPbfuc NPbglc NPbgal NPbxyl MUbglc 0.59 1.05 ... ctacttcgctccgatcctaaacgc-3¢; and mutation M45 3A,< /b> 5¢-ggacaa ctttgaatgggcggagggttatattgag-3¢ The incorporation of mutations was verified by DNA sequencing Expression of recombinant Sfbgly BL21 DE3 cells...

Ngày tải lên: 18/02/2014, 17:20

... http://www.nap.edu/catalog/12793.html ACRONYMS AND ABBREVIATIONS AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC CDC CHIP CI CIA CMS DIS DTaP DUIT DVH EIA EIP EPSDT FDA FEHBP FQHC HAV HBIG ... vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination rates than non-Hispanic white children Regarding vaccination of children and adults ... hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Key characteristics of hepatitis B and hepatitis C are summarized...

Ngày tải lên: 06/03/2014, 01:20

... there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination rates than non-Hispanic white ... because HBV and HCV are the leading causes of this type of cancer Key characteristics of hepatitis B and hepatitis C are summarized in Table 1-1 and discussed below and in later chapters 19 Copyright ... AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC American Association for the Study of Liver Diseases Advisory Committee on Immunization Practices American College of Obstetricians...

Ngày tải lên: 06/03/2014, 01:20

... peptide bond absorption band causing no changes in the far-UV CD spectra So, the broad band centred at 270 nm obtained in bLG CD spectra upon encapsulation on AOT RM may arise from the changes in nature ... Stern–Volmer constants and bimolecular rate constants for the – dynamic and static quenching of b- lactoglobulin (bLG) by acrylamide in water and in sodium bis(2-ethylhexyl) sulfosuccinate (AOT) reverse ... which made it difficult to detect a < /b> reliable CD signal below 200 nm AOT itself is chiral and although a < /b> background subtraction was performed the spectra had significant noise, which could not be...

Ngày tải lên: 07/03/2014, 15:20

... oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ... CAATCTCCCATCCGTTGATGTG-3¢, and pcerulean-N1 pBOS-HA was constructed by insertion of the annealed fragment of the synthesized oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ ... was changed to GGA by using primers 5¢-CCCAAGC TTATGGATGGAGGAGGAGAAAAC-3¢ and 5¢-ACGT ACCGGTCCACAATCTAGGAAGTTTGCAGC-3¢ After digestion of the PCR fragment by EcoRI and AgeI, the fragment was inserted...

Ngày tải lên: 16/03/2014, 05:20

... the aquatic unicellular green alga Chlamydomonas reinhardtii and land plants In particular, the greater extent of state transitions in Chlamydomonas compared with higher plants, such as Arabidopsis, ... domain composed of 15 subunits The organization of the plant and green algal PSII core dimer and its associated antenna, the LHCII, has been revealed by cryo-electron microscopy and single particle ... adopting an alternative approach, a < /b> small family of three thylakoid-associated kinases (TAKs) have been identified in A < /b> thaliana as candidates for LHCII kinases through screening for proteins that interact...

Ngày tải lên: 16/03/2014, 06:20

... mutated codons for Q39N and Q39E, respectively For mutation at position E451, the primer sequence was 5¢-GGAGTCTAATGGACAACTTTNNNTGGATGGA GGGTTATATTGAGCG-3¢, with GAC, CAA and TCA as mutated codons ... b- glucosidases from Pyrococcus furiosus and Agrobacterium faecalis share a < /b> common catalytic mechanism Biochemistry 37, 17170–17178 ´ Paloma, F., Canada, F.J., Barbero-Jimenez, J & Martı´ n-Lomas, ... contained a < /b> common segment (underlined) and mutated codon (NNN, in bold) Thus, the primer sequence used on mutations at position 39 was 5¢-CGCTACAGCCTCCTACNNNAT CGAAGGTGCTTGG-3¢, with AAC and GAG as...

Ngày tải lên: 16/03/2014, 18:20

... of bacterial polysaccharides in plant pathogens Ann Rev Phytopathol 33, 173–197 31 Reuhs, B. L., Kim, J.S & Matthysse, A.< /b> G (1997) Attachment of Agrobacterium tumefaciens to carrot cells and Arabidopsis ... b- effect (< 0.5 p.p.m) suggests identical absolute configurations of the glycosylating sugar (glucose) and the 4-substituted ManpNAc3NAcA residue [26,27] The signals for a-< /b> D-Glcp and b- D-ManpNAc3NAcA ... Kdn-based polymer (II), and b- glucosylated ribitol teichoic acid (III) The percentage of the teichoic acid ( 10 % mass of the cell wall) was calculated from the content of the teichoic acidlinked...

Ngày tải lên: 17/03/2014, 10:20

... PCR The pair pcp 15, GAG CACGGCMGRGAGGAGGC/PCP; 6, SGCSARGTG SCCSACSGT gave a < /b> clone encoding a < /b> partial sequence of NpsB DNA manipulations All DNA manipulations were performed according to published ... in the case of D-alanyl-lipoteichoic acid [39±43], where they activate aromatic carboxylic acids or an amino acid such as alanine as adenylates, which in turn are loaded to speci c PCP domains ... b- aminobutyric acid, c- aminobutyric acid and e-amino caproic acid were not activated Thus, the activating enzyme appears to be strictly speci c for b- lysine The strict speci®city of the enzyme for b- lysine...

Ngày tải lên: 17/03/2014, 17:20

... hepatitis B and hepatitis C are important public health problems and that there are several barriers to prevention and control efforts, such as a < /b> lack of knowledge and awareness about chronic ... chronic hepatitis B and hepatitis C, and conduct targeted active surveillance to monitor incidence and prevalence of hepatitis B and hepatitis C in populations not fully captured by core surveillance ... soon as they are stable and washed School-entry mandates have been shown to increase hepatitis B vaccination rates and to reduce disparities in vaccination rates Therefore, the committee recommends...

Ngày tải lên: 22/03/2014, 17:20

... Psychrophilic class < /b> C b- lactamase C Michaux et al classes A,< /b> C and D are active site serine enzymes, whereas class < /b> B b-lactamases require one or two zinc ions for their activity [1] Only class < /b> C ... 2008 The Authors Journal compilation ª 2008 FEBS C Michaux et al Psychrophilic class < /b> C b- lactamase ˚ Table Percentage identity between the four b- lactamases and rmsd values (A)< /b> for Ca atoms among ... of an enzyme activity: crystallographic structure at 2 -A < /b> resolution of cephalosporinase from the ampC gene of Enterobacter cloacae P99 and comparison with a < /b> class < /b> A < /b> penicillinase Proc Natl Acad...

Ngày tải lên: 23/03/2014, 07:20

... Immunodetection of CCT a-< /b> subunit in the cytoplasm of E focardii SDS/PAGE of an E focardii cytoplasmic fraction (20 lg, lane 1) and of CCT purified from rabbit reticulocyte lysate (2 lg and lg in lanes and ... Fig 2B In the absence of Cof A,< /b> b- T1 binds to CCT (upper arrow) No folded products are generated as described [14] In the folding reaction containing both CCT and Cof A,< /b> an additional band is ... using rabbit CCT, labeled b- T1 and unlabeled b5 , as described in Melki et al [32] In a < /b> control reaction, a < /b> competition experiment was performed using labeled and unlabeled b5 The reaction products...

Ngày tải lên: 23/03/2014, 21:20

... GCC GCG CCC GGC GCG GAA CCC-3Â; CF5NdeI 5Â-AA CAT ATG ATC GAC CTG ACC GCA GCC-3Â; CF5XhoI 5Â-AA CTC GAG GTG GGT GTC CCA CTG GCC-3Â PCR mixtures contained 10 lm primers, mm each deoxyribonucleoside ... the Biotechnology Laboratory at the University of British Columbia N-Acetylchitooligosaccharides (Dp 26) were from Seikagaku America (Falmouth, MA, USA) Chromogenic substrates and hyaluronic acid ... pNP-GlcNAc, and 66 lm and 129.1 s)1 for p-nitrophenyl b- N-acetylgalactosaminide (pNP-GalNAc) at 25 C An activity ratio (pNP-GlcNAc pNP-GalNAc) of 3.7 was determined, a < /b> value in the range commonly...

Ngày tải lên: 30/03/2014, 10:20