activating transcription factor 3

... a FEBS Journal 2 73 (2006) 37 79 37 91 ª 2006 The Authors Journal compilation ª 2006 FEBS S Zhang et al 30 31 32 33 34 35 36 37 38 mammalian MAPKKK that activates SAPK ⁄ JNK and p38 signaling pathways ... JNK-p38 MAP kinases on apoptosis Science 270, 132 6– 133 1 Davis RJ (19 93) The mitogen-activated protein kinase signal transduction pathway J Biol Chem 268, 145 53 14556 Hill CS & Treisman R (1995) Transcriptional ... Endocrine Rev 15, 1 63 201 Marzban L, Park K & Verchere CB (20 03) Islet amyloid polypeptide and type diabetes Exp Gerontol 38 , 34 7– 35 1 Butler AE, Janson J, Soeller WC & Butler PC (2003b) Increased...

Ngày tải lên: 07/03/2014, 12:20

... this study Name Sequence(5¢- to -3 ) Purpose PLuc-KCTD10-R P ()609 ⁄ +30 )-F1 P ( )34 3 ⁄ +30 )-F2 P ()241 ⁄ +30 )-F3 P ()2 03 ⁄ +30 )-F4 P ()108 ⁄ +30 )-F5 P () 13 ⁄ +30 )-F6 P ()609 ⁄ )241)-R AP-2a ⁄ ... ubiquitin protein ligase E3B (UBE3B, NM_1 834 15) The 5¢-flanking region was very short, only  38 0 bp between the start the codon of human KCTD10 and 5¢ cDNA end of UBE3B (Fig 1B) The transcription start ... transcription by two factors that bind promoter and enhancer sequences of the human metallothionein gene and SV40 Nature 32 5, 36 8 37 2 Getman DK, Mutero A, Inoue K & Taylor P (1995) Transcription factor repression...

Ngày tải lên: 30/03/2014, 02:20

... those from BPMs [30 ] In these experiments, BPM11–189 PM B MATH RAP2.4 38 t pu In ST G 150 RAP2. 13 fragment Empty vector 142 261 2.4 E AP t pu In BPM11–189 33 4 214 AP2 81 60 13 P2 AP2 RA :R : ... (DFG) grants HE3224 ⁄ 5-1 and 5-2 and Washington State University to HH Accession numbers BPM1 (At5g19000 ⁄ Q8L765); BPM2 (At3g06190 ⁄ Q9M8J9); BPM3 (At2g39760 ⁄ O22286); BPM4 (At3g 037 40 ⁄ Q9SRV1); ... substrate adaptors to CUL3-based E3-ligases They also assemble with ERF ⁄ AP2 transcription factors, and this interaction serves to bring bound ERF ⁄ AP2 proteins to the core E3-ligase Docking of...

Ngày tải lên: 18/02/2014, 06:20

... 2494–2504 ª 2009 The Authors Journal compilation ª 2009 FEBS 25 03 Sox9 regulates AP-2e in hypertrophic chondrocytes 28 29 30 31 32 33 34 35 36 A.-K Bosserhoff et al and potential therapeutic targets ... 54, 83 94 2504 37 Schorle H, Meier P, Buchert M, Jaenisch R & Mitchell PJ (1996) Transcription factor AP-2 essential for cranial closure and craniofacial development Nature 38 1, 235 – 238 38 Bi ... 5¢-GAGGCCAGCGAAGA ATAGTG -3 , and Sox9_1prom_rev, 5¢-GTTCTCTC CCTTTTCCCCAGC -3 ( 234 bp fragment); Sox9_2prom_ for, 5¢-CAGTCACTCAACAGTCTCTGG -3 , and Sox9_2 prom_rev, 5¢-CACTTCGCTCTCAGGCTTC -3 (2 13 bp fragment)...

Ngày tải lên: 18/02/2014, 08:20

... averages CV% Wells S1 S2 S1 S1 S3 S4 S5 S2 S4 S2 S6 56 612 73 727 53 686 48 659 18 010 35 34 22 490 80 224 38 71 67 068 93 760 7.6 5.7 6.9 4.4 12.5 3. 7 10.2 6 .3 19 .3 5.1 4.5 9 9 8 6 6 below 10% The ... 50 15 10 Control 0.01 B 0.1 30 MEF Control µg protein Counts ×1 03 B 35 Heat shock Heat shock MEF 150 10 nM Probe Counts ×1 03 HeLa 200 Control Counts ×1 03 Counts ×1 03 35 A 100 µg protein 10 µg protein ... binding of transcription factors in cell and tissue lysates Although we have developed the assay using HSF1, it can easily be adapted for the study of any transcription factor The 736 8 method...

Ngày tải lên: 18/02/2014, 14:20

... (28 38 ) Helix III ( 43 59) Helix III ( 43 52) Helix III ( 53 59) Loop ( 23 27) Tight turn (39 –42) N-terminus (1–9) C-terminus (60–67) 3. 78 3. 84 3. 63 3. 83 3 .38 3. 79 3. 69 2. 83 2.62 a J(xN) (0 .30 ) (0 .37 ) ... 3. 83 3 .38 3. 79 3. 69 2. 83 2.62 a J(xN) (0 .30 ) (0 .37 ) (0 .34 ) (0.26) (0.25) (0.12)a (0.11) (0.52) (0 .30 ) 0 .35 4 0 .35 5 0 .34 3 0 .35 4 0 .32 9 0 .34 0 0 .34 2 0.271 0.262 J(0.87xH) (0.008) (0.029) (0.020) (0.017) ... 0.92 0. 63 0.58 Æseæwa Æseæ (0.04) (0.04) (0.08) (0.06) (0.09) (0.06) (0.06) (0.08) (0.04) (0.19) (0.09) 19 83 24 93 1486 1885 1 030 1 630 134 5 1 038 1960 805 514 (406) ( 137 4) (780) (710) (6 13) (809)...

Ngày tải lên: 18/02/2014, 16:20

... other transcription factors We chose E2F [29 ,30 ], ETS1 [31 ,32 ], hypoxia-inducible factor (HIF-1) [33 ], hepatocyte nuclear factor (HNF4), and c-Myc [34 ], and collected seed groups for these factors ... (positive control) ENSG00000197 635 ENSG00000142 539 ENSG000001 232 40 ENSG000001 734 32 ENSG000001 637 39 ENSG00000081041 ENSG00000169245 ENSG00000117151 ENSG00000 135 604 ENSG000000 234 45 ENSG00000196954 ENSG00000166718 ... reveals involvement of the transcription factor c-rel J Neurosci 24, 39 33 39 43 Barenco M, Tomescu D, Brewer D, Callard R, Stark J & Hubank M (2006) Ranked prediction of p 53 targets using hidden variable...

Ngày tải lên: 18/02/2014, 18:20

... Source W3 03 1B MATa ura3-1 leu2 -31 12 his3-11,15 trp1-1 ade2-1 can1-100 (W3 03- 1A - MATa, W3 03- D - MATa ⁄ a) MATa ura3-52 leu2-D1 his3-D200 trp1-D1 ade2-10oc lys2-801a MATa ura3-52::pCS12ZI URA3 (isogenic ... YPH499) MATa ura3-1::pCS12ZI URA3 (isogenic to W3 03- 1B) MATa ura3-1::pCS12ZI URA3 LEU2 (isogenic to W3 03- 1B) MATa ura3-1::pCS12ZI URA3 LEU2 War1-28 (isogenic to W3 03- 1B) MATa war1D::HIS3MX6 (isogenic ... lys2-801a War1-42 MATa ura3-52::pCS12ZI URA3 War1-42-3HA HIS3MX6 (isogenic to YPH499) MATa ura3-1::pCS12ZI URA3 LEU2 War1-28-3HA HIS3MX6 (isogenic to W3 03- 1B) MATa ⁄ a ura3-1 LEU2 his3-11,15 trp1-1 ade2-1...

Ngày tải lên: 19/02/2014, 00:20

... Anticancer Drugs 3, 32 3 33 0 11 Xia Z, Dickens M, Raingeaud J, Davis RJ & Greenberg ME (1995) Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis Science 270, 132 6– 133 1 12 Kulik G & Weber ... ‘Research for the Future’ Program from the Japan FEBS Journal 2 73 (2006) 37 43 37 55 ª 2006 The Authors Journal compilation ª 2006 FEBS 37 53 Role of AP1 in EGF-mediated cell protection K Takeuchi et ... forkhead transcription factor FKHR [25], a proapoptotic transcription factor, thereby inhibiting them, the PtdIns3K ⁄ Akt signaling pathway has emerged as the major mechanism by which growth factors...

Ngày tải lên: 19/02/2014, 06:20

... L r Yeast ER model Proteome Internet 230 851 3. 70 0.17 4.50 )0.18 230 851 3. 70 0.015 4.15 )0.005 1870 4488 2.40 0.07 6.81 )0.15 10 100 38 38 0 3. 80 0.24 3. 70 )0.19 N total number of nodes, l total ... Growth Factor Rev 12, 73 90 73 Hartl M, Bader AG & Bister K (20 03) Molecular targets of the oncogenic transcription factor jun Curr Cancer Drug Targets 3, 41–55 74 Pelengaris S & Khan M (20 03) The ... 1551–1555 37 Vogelstein B, Lane D & Levine AJ (2000) Surfing the p 53 network Nature 408, 30 7 31 0 38 Vogelstein B & Kinzler KW (2001) Achilles’ heel of cancer? Nature 412, 865–866 39 Davidson I (20 03) ...

Ngày tải lên: 19/02/2014, 07:20

... CTTCACCATGGAGCGGATCCCCAGCGCGCAACC AC -3 ) and a 3 -terminus primer (one of 5¢-TCTA GACTAGGAGCTGATCAGGTCACTGCTAGTGAAA TGG -3 , 5¢-TCTAGACTACCCACTCGAGTGAGCGA AAGTCCGCTGG -3 or 5¢-TCTAGACTATTGACCTG TTTCGACATTTCTCCCTGACAGCTC -3 ) were ... addition to BMAL1, DEC1 can bind to various transcription factors such as USF2 [29], MASH1 [ 23] and E47 [31 ], or to co-repressors such as HDAC1, mSin3A and NcoR [24] USF2-DEC1 heterodimer formation ... Dev 14, 135 3– 136 3 Preitner, N., Damiola, F., Lopez-Molina, L., Zakany, J., Duboule, D., Albrecht, U & Schibler, U (2002) The orphan nuclear receptor REV-ERBalpha controls circadian transcription...

Ngày tải lên: 19/02/2014, 16:20

... 272 (2005) 1676–1687 ª 2005 FEBS ESE-1 activates COX-2 expression 33 34 35 36 37 38 39 40 41 expression by ETS transcription factors Oncogene 14, 2651–2660 White LA, Maute C & Brinckerhoff CE ... epithelium-specific transcription factor, FEBS Journal 272 (2005) 1676–1687 ª 2005 FEBS F T Grall et al 24 25 26 27 28 29 30 31 32 ESE-1, a member of the ets family Mol Cell Biol 17, 4419–4 433 Tymms MJ, ... metalloproteinases collagenase (MMP-1) and stromelysin (MMP -3) are auxiliary elements that regulate basal and phorbolinduced transcription Connect Tissue Res 36 , 32 1 33 5 Gutman A & Wasylyk B (1990) The collagenase...

Ngày tải lên: 19/02/2014, 17:20

... Res 22, 34 33 34 39 Ruet A, Camier S, Smagowicz W, Sentenac A & Fromageot P (1984) Isolation of a class C transcription factor which forms a stable complex with tRNA genes EMBO J 3, 34 3 35 0 Srinivasan ... ester 12-O-tetradecanoylphorbol- 13- acetate (TPA) is mediated by transcription factor IIIB Mol Cell Biol 14, 33 9 34 7 36 Palida FA, Hale C & Sprague KU (19 93) Transcription of a silkworm tRNA (cAla) ... Regulation of pol III transcription 10 11 12 13 14 15 16 transcription factor IID complex as a general RNA polymerase III transcription factor Proc Natl Acad Sci USA 89, 1949–19 53 White RJ, Rigby...

Ngày tải lên: 20/02/2014, 02:21

... contract No P25 73 from 25 November 2009) References 13 14 Fisher SH (1999) Regulation of nitrogen metabolism in Bacillus subtilis: vive la difference! Mol Microbiol 32 , 2 23 232 Nakano M, Hoffmann ... 8 530 –8 539 Kayumov A, Heinrich A, Sharipova M, Iljinskaya O & Forchhammer K (2008) Inactivation of the general transcription factor TnrA in Bacillus subtilis by proteolysis Microbiology 154, 234 8– 235 5 ... Bacteriol 190, 32 1 33 1 22 Saxild HH & Nygaard P (1987) Genetic and physiological characterization of Bacillus subtilis mutants resistant to purine analogs J Bacteriol 169, 2977–29 83 23 Sambrook J,...

Ngày tải lên: 06/03/2014, 00:21

... VP16 ** * n159 4 93 VP16 L140P 4 93 VP16 3P Gap Step ** I186P 47.5 32 .5 ** 25 * 10 20 Fold activation C D WT EGS (mM) L140P I186P 1.0 3. 0 1.0 3. 0 1.0 3. 0 WT L140P I186P 3P G S 3P G S 3P G S 240 140 ... Morimoto RI (19 93) Mouse heat shock transcription factors and prefer a trimeric binding site but interact differently with the HSP70 heat shock element Mol Cell Biol 13, 33 70– 33 83 27 Kroeger PE ... shock transcription factor through two different types of heat shock elements J Biol Chem 282, 1 033 3–1 034 0 10 Sakurai H & Takemori Y (2007) Interaction between heat shock transcription factors...

Ngày tải lên: 07/03/2014, 00:20

... Journal 276 (2009) 31 37 31 47 ª 2009 The Authors Journal compilation ª 2009 FEBS M Harper et al 12 13 14 15 16 17 18 19 20 21 JNK ⁄ p38MAPK signaling modules & transcription factors Proc Natl Acad ... Martin A & Prigent C (20 03) Preparation & characterization of a human aurora-A kinase monoclonal antibody Mol Cell Biochem 2 43, 1 23 131 FEBS Journal 276 (2009) 31 37 31 47 ª 2009 The Authors Journal ... might be correlated with its lamin-binding FEBS Journal 276 (2009) 31 37 31 47 ª 2009 The Authors Journal compilation ª 2009 FEBS 31 43 Phosphorylation-dependent binding of MOK2 M Harper et al B A C...

Ngày tải lên: 07/03/2014, 01:20

... 5¢-AGTTTCGCTCTTGTCT CCCAG -3 ; P1 antisense, 5¢-ATGGCGAAACCCTGTCTC TAC -3 ; P2 sense, 5¢-AGACAGCCGTTTTACACGCAG -3 ; P2 antisense, 5¢-CACCGAGAAATCGAAATCACC -3 ; P3 sense, 5¢-TAGGAAGGTTGTATCGCGGAGG -3 ; and P3 antisense, ... of China (30 800557 and 30 671184) References Bai L & Merchant JL (2000) Transcription factor ZBP89 cooperates with histone acetyltransferase p300 during butyrate activation of p21waf1 transcription ... bovine adrenodoxin gene and regulate transcription Biochemistry 39 , 434 7– 435 7 Law GL, Itoh H, Law DJ, Mize GJ, Merchant JL & Morris DR (1998) Transcription factor ZBP-89 regulates the activity...

Ngày tải lên: 07/03/2014, 02:20

... 5¢-GAGUUUCUCAUGCUUCCU CUU -3 ) matched bases 945–9 63; and the third siRNA ZF5 (5¢-GGUCCUGAACUACAUGUACUU -3 and 5¢-GUAC AUGUAGUUCAGGACCUU -3 ) matched bases 33 3 35 1 of the ZF5 mRNA sequence (accession number ... 5¢-TACTCCTTGGAG GCCATGT -3 ) (18 cycles), ZF5 (primers 5¢-CCCCTC AAGCCTTAACAT -3 and 5¢-TCTCCACTTTCCAGGC AA -3 ) (27 cycles), FMR1 (primers 5¢-GGGTGAGGATT GAGGCTGA -3 and 5¢-GCCGTGCCCCCTATTTCT -3 ) (34 cycles), ... (5¢-GGCCTTCAAGGCATTAAG -3 , 5¢-AAACAAATGG CCTGTCCG -3 ) spanned a 958 bp 5¢-part of the ZF5 coding region; the second pair (5¢-CCCCTCAAGCCTT AACAT -3 , 5¢-TCTCCACTTTCCAGGCAA -3 ) spanned a 686 bp 3 -part of...

Ngày tải lên: 07/03/2014, 05:20

... P66R + W88R 1.01 ± 0.04 proteins 6 .3 ± 1.1 2. 63 ± 0 .31 2.71 ± 0 .32 8.17 ± 2.2 3. 81 ± 0 .34 0 .37 ± 0.08 3. 33 ± 0.65 2.59 ± 0.4 4.41 ± 0.84 ND ND ND ± 0 .39 2.7 ± 0 .31 2.12 ± 0.2 ND ND ND 1.82 ± 0.1 ... 27 28 29 30 31 32 33 34 35 36 Gal A et al (2004) Possible association of mitochondrial transcription factor A (TFAM) genotype with sporadic Alzheimer disease Neurosci Lett 36 9, 219–2 23 Kanai Y, ... H, Kang D & Kohno K (20 03) P 53 physically interacts with mitochondrial transcription factor A and differentially regulates binding to damaged DNA Cancer Res 63, 37 29 37 34 Dinardo MM, Musicco C,...

Ngày tải lên: 07/03/2014, 05:20

... Downward J & Evan G (1997) FEBS Journal 2 73 (2006) 234 5– 235 6 ª 2006 The Authors Journal compilation ª 2006 FEBS E.M Harrison et al 28 29 30 31 32 33 34 35 36 37 38 39 Suppression of c-Myc-induced apoptosis ... PI3K inhibitor LY294002 (Fig 3B), or its inactive analog LY3 035 11 (Fig 3C), ACHN cells were treated with insulin (200 nm) for h to determine HO-1 protein accumulation and for 30 to confirm GSK3b ... (200 nM) for 30 (A) Other groups were pretreated with the PI3K inhibitor LY294002 (B), or its inactive analog LY3 035 11 (C) for 30 min, and then treated with insulin (200 nM) for 30 to determine...

Ngày tải lên: 07/03/2014, 12:20