acid with the salifiable bases in the order of affinity a

Báo cáo khoa học: "The order of prenominal adjectives in natural language generation" doc

Báo cáo khoa học: "The order of prenominal adjectives in natural language generation" doc

... as a vector of 16 features (the last characters of a and the last characters of b) and a class a b or b a Constructing the instance base and testing the classification was performed using the ... Given an unordered pair {a, b}, we can assign it some canonical order to get an instance ab Then, if a precedes b more often than b precedes a in the training data, we assign the instance ab to the ... is true, and b, a is found more often than a, b , then b a If neither order appears in the training data, then neither a b nor b a and an order must be randomly assigned Shaw and Hatzivassiloglou...

Ngày tải lên: 08/03/2014, 05:20

8 420 0
Báo cáo khoa học: Role of Ca2+/calmodulin regulated signaling pathways in chemoattractant induced neutrophil effector functions Comparison with the role of phosphotidylinositol-3 kinase ppt

Báo cáo khoa học: Role of Ca2+/calmodulin regulated signaling pathways in chemoattractant induced neutrophil effector functions Comparison with the role of phosphotidylinositol-3 kinase ppt

... GSK- 3a activity by means of the classical MAPK pathway [42] There are also indications that phosphorylation of GSK- 3a can be mediated by protein kinase A or by a pathway that involves the mammalian ... CaMKI forward: 5¢-CGGAGGACA TTAGAGACA-3¢, reverse: 5¢-CTCGTCATAGAAGGG AGG-3¢; CaMKII forward: 5¢-GGTTCACGGACGAGT ATC-3¢, reverse: 5¢-TGGCATCAGCTTCACTGTA-3¢; CaMKIV forward: 5¢-GATGAAAGAGGCGATCAG-3¢, ... Murray, A. W & Ferrante, A (1999) Role of the extracellular signal-regulated protein kinase cascade in human neutrophil killing of Staphylococcus aureus and Candida albicans and in migration Infect...

Ngày tải lên: 08/03/2014, 10:20

10 538 0
Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot

Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot

... ACTAAGCTTAAAAGGGGACTTCTCTGTAATGGTTCAGGGGTGG ACTAAGCTTAAAAGGGGACTTCTAGGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGACTGATCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGCATTCTCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGTTGACTTCTCTGGCATGGTTCAGGGG ACTAAGCTTAACCGGGGACTTCTCTGGCATGGTTCAGGGG ... ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCAGGTTTGGAGGCACCTGGGA ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCCTGGGTGGAGGCACCTG ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGGGCAGGGGTGGAGGCAC ACTAAGCTTAAAAGGGGACTTCTCTGGCAGTGTTCAGGGGTGGAGG ACTAAGCTTAAAAGGGGACTTCTCTGTAATGGTTCAGGGGTGG ... mechanism is important as a means of attenuating and counterbalancing hormone-induced transactivations, acting transiently as part of a cycle of cofactors at the target promoters, and allowing...

Ngày tải lên: 16/03/2014, 10:20

12 399 0
synthesis of wo3 in nanoscale with the usage of sucrose ester

synthesis of wo3 in nanoscale with the usage of sucrose ester

... environmental contamination and also the residual surfactants absorbed on the nanoparticles The C1s peak in the XPS results (Fig 5) is from carbon contamination that is very usual and in fact, it is often ... deionized water and absolute ethanol in order to remove the surfactant, residual reactants and The study of the morphology and composition of the calcinated WO3 nanoparticles were done by variable ... 15, at least 70% monoester) in a mixture with di- and polyesters of stearic and palmitic acids The oil phase consists of a 1:1 weight ratio of tetradecane and l-butanol The addition of the co-solvent...

Ngày tải lên: 20/03/2014, 13:08

6 394 0
In Partnership with the Government of Kenya: Kenya Strategy 2011-2014 doc

In Partnership with the Government of Kenya: Kenya Strategy 2011-2014 doc

... vaccine evaluations Malaria Vaccine Initiative (Gates Foundation): Supports malaria vaccine evaluations Coordination/integration: Further integrating efforts and coordinating with GOK and partner ... the basis of the indicators Kenya will measure as part of GHI as a whole and the Learning Agenda specifically; e.g., indicator = the number of pregnant women attending ANC during the course of ... principles of country ownership and a whole -of- government approach, strengthening and leveraging partnerships and increasing impact through strategic coordination and integration Approach To maintain and...

Ngày tải lên: 23/03/2014, 06:20

31 425 0
báo cáo hóa học:" General anxiety, depression, and physical health in relation to symptoms of heart-focused anxietya cross sectional study among patients living with the risk of serious arrhythmias and sudden cardiac death" doc

báo cáo hóa học:" General anxiety, depression, and physical health in relation to symptoms of heart-focused anxietya cross sectional study among patients living with the risk of serious arrhythmias and sudden cardiac death" doc

... of the article GEE contributed to the statistical analyses and the editing of the manuscripts KN participated in preparation and the editing of the article All authors have read and approved the ... draft AH has been the corresponding author NØ participated in the preparation and conduct of the study and the editing of the article BR contributed to shaping of the article and the editing of ... dyspnoea, chest pain, and exertional angina [7] The cardiac symptoms manifesting in these patients can lead to proper management of the disease and preventive measures, such as medication (beta blockers...

Ngày tải lên: 20/06/2014, 15:20

10 454 0
Báo cáo toán học: " Acute myocardial infarction and coronary vasospasm associated with the ingestion of cayenne pepper pills in a 25-year-old male" pot

Báo cáo toán học: " Acute myocardial infarction and coronary vasospasm associated with the ingestion of cayenne pepper pills in a 25-year-old male" pot

... associated with capsaicin Capsaicin, a sympathomimetic agent, may be implicated in the initiation of coronary vasospasm and acute myocardial infarction in the absence of substance abuse, particularly in ... and his chest pain began after using oral capsaicin for slimming for days The patient sustained an extensive inferior myocardial infarction Coronary artery spasm in association with myocardial ... with cardiotoxicity, including coronary vasospasm, supraventricular tachycardia, and acute atrial fibrillation [1,7] Capsaicin also prolongs the cardiac action potential in atrial and ventricular...

Ngày tải lên: 20/06/2014, 20:20

14 392 0
Human resources for industrialization and modernization associated with the development of knowledge based economy in the province of thua thien hue at the present time

Human resources for industrialization and modernization associated with the development of knowledge based economy in the province of thua thien hue at the present time

... agriculture and rural areas and outlines the rules of movement of human resources in the industrialization and modernization in agriculture and rural areas At the same time, the author analyzes the current ... Asian: increase social awareness of lifelong learning; emphasize retraining and advanced training; reform regular educational system to encourage and develop the system of irregular education; the ... author analyzes the current status of human resources in the Mekong Delta in the direction of industrialization and modernization in such aspects as: Actual condition of Education-Training in human...

Ngày tải lên: 22/07/2014, 18:29

267 517 0
The Order of Adjectives in a Series docx

The Order of Adjectives in a Series docx

... friendly fat young man man a 18th century a Scottish fantastic castle 10 a horrible greedy businessman fat friendly young our boring tall headmaster a business horrible greedy 11 a big old brown bear ... bear tall our headmaster boring a long dark wooden table a big old brown bear 12 a self-righteous middle-class student wooden dark a table long a beautiful old Spanish city city a Spanish beautiful ... old maths teacher a perfect new system my teacher old maths smelly a small old black Turkish box new a perfect system a fantastic 18th century Scottish castle black small box Turkish a old a friendly...

Ngày tải lên: 27/07/2014, 17:20

2 413 0
Báo cáo lâm nghiệp: "Variability in density of spruce (Picea abies [L.] Karst.) wood with the presence of reaction wood" potx

Báo cáo lâm nghiệp: "Variability in density of spruce (Picea abies [L.] Karst.) wood with the presence of reaction wood" potx

... of compression wood are marked as data file CW/CW in calculations The average ring width in the sample was set in compliance with ČSN 49 0102 standard The width was measured using a stereo magnifier ... District Habrůvka, area 164 C 11 The average annual temperature in this locality is 7.5°C and the average annual precipitation is 610 mm The tree stem axis was diverted from the direction of the gravity ... statistical results of ANOVA Wood density decreases in the CW zone with the increasing height In the side zones SWL and SWR it is also possible to see a gradual decrease in density with the increasing...

Ngày tải lên: 07/08/2014, 03:22

9 294 0
Báo cáo toán học: "The order of monochromatic subgraphs with a given minimum degree" doc

Báo cáo toán học: "The order of monochromatic subgraphs with a given minimum degree" doc

... M and adding the original edges with both endpoints in S Also, add to P all other vertices of V (G) \ (X ∪ S) and all their incident edges Notice that the obtained subgraph is a k-subgraph of ... a [2] A Bialostocki , P Dierker and W Voxman, Either a graph or its complement is connected : A continuing saga, Mathematics Magazine, to appear [3] D W Matula, Ramsey Theory for graph connectivity, ... that contains a vertex of X, a contradiction Now assume s < k (clearly s ≥ 1) We can repeat the same argument where instead of M we use a complete graph on S, and similar computations hold Proof...

Ngày tải lên: 07/08/2014, 07:21

8 310 0
Báo cáo lâm nghiệp: "Extended length rotation to integrate timber and pine nut production with the conservation of structural diversity in a Pinus pinea (L.) forest" pdf

Báo cáo lâm nghiệp: "Extended length rotation to integrate timber and pine nut production with the conservation of structural diversity in a Pinus pinea (L.) forest" pdf

... to calculate the most likely of the four rot risk classes as a function, for each fixed basal area, of the age and the dominant height of the stand, obtaining for each value of basal area a graphic ... distribution of the age of the dominant strata and the site index within the forest area can be seen in Figure The classification of the forest area in function of the stand age and the site index is ... number of pairs of samples ua and ua + d which distance from each other is within the distance lag centred at d, and z(ua ) and z(ua +d) are the values that the variable z takes at samplesua and ua...

Ngày tải lên: 07/08/2014, 16:20

9 462 0
Báo cáo y học: "Association of Adiposity, Cardiorespiratory Fitness and Exercise Practice with the Prevalence of Type 2 Diabetes in Brazilian Elderly Women" pot

Báo cáo y học: "Association of Adiposity, Cardiorespiratory Fitness and Exercise Practice with the Prevalence of Type 2 Diabetes in Brazilian Elderly Women" pot

... research in many countries, however, there are no recent investigations involving the Brazilian population The last available data in Brazil was published in 1998, showing that the prevalence of ... the National Health Council concerning research involving human subjects Measurements In order to avoid inter-examinator variability, all anthropometrics measures were obtained by a single trained ... health initiatives to prevent diabetes in managed care and community setting [1, 22, 29] Health professionals should encourage individuals of all ages to maintain an active life-style that can attenuate...

Ngày tải lên: 08/08/2014, 16:23

5 427 0
Báo cáo khoa học: "Variation in the phenology of shoot elongation between geographic provenances of maritime pine (Pinus pinaster) - implications for the synchrony with the phenology of the twisting rust fungus" potx

Báo cáo khoa học: "Variation in the phenology of shoot elongation between geographic provenances of maritime pine (Pinus pinaster) - implications for the synchrony with the phenology of the twisting rust fungus" potx

... variances Infection percentages were analysed using a generalization of the analysis of variance adapted to categorical data analysis (CATMOD procedure of SAS) A log-linear model, with a maximumlikelihood ... analysis of variance (table VI) were always maintained after adjustment with the covariable Tamjout and Leiria remained the earliest and latest provenances, respectively Rankings of intermediate ... pinaster Indeed, P pinaster is thought to have appeared in the northern Landes area approximately 000 years ago, at a time when P sylvestris was the dominant species (Baradat and Marpeau-Bezard,...

Ngày tải lên: 08/08/2014, 19:21

16 417 0
Báo cáo y học: "κ Increased AP-1 and NF-κB activation and recruitment with the β combination of the proinflammatory cytokines IL-1β, tumor necrosis factor alpha and IL-17 in rheumatoid synoviocyte" ppt

Báo cáo y học: "κ Increased AP-1 and NF-κB activation and recruitment with the β combination of the proinflammatory cytokines IL-1β, tumor necrosis factor alpha and IL-17 in rheumatoid synoviocyte" ppt

... was evaluated by the measurement of the mean green intensity of the nuclear staining with image analysis software The quantitative data are presented in Table Results are compared with the condition ... was 5′-GGG TCA GAA GGA TTC CTA TG-3′ and the downward primer was 5′-CTC CTT AAT GTC ACG CAC GAT TTC-3′ The housekeeping gene β-actin was amplified as an internal control PCR fragments were analyzed ... France) The mean green intensity of the nuclear staining was quantified with Lucia® image analysis software in 10 randomly selected cells RNA isolation and RT-PCR RNA extraction was performed with...

Ngày tải lên: 09/08/2014, 01:23

9 414 0
Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc

Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc

... hemorrhages and giant capillaries, moderate loss of capillaries with some avascular areas, mild disorganization of the capillary architecture and absent or some ramified capillaries Finally, the late pattern ... in patients with avascular areas argue for a role of endostatin in the pathogenesis of microvascular abnormalities in SSc For example, Hebbar et al found a correlation of endostatin with cutaneous ... areas by clinical palpation and was rated 0–3, with a maximum total score of 51 [20] Nailfold videocapillaroscopy was performed in a blinded manner for the analysis of microvascular abnormalities...

Ngày tải lên: 09/08/2014, 06:22

10 432 0
Báo cáo y học: "Relaxin''''s induction of metalloproteinases is associated with the loss of collagen and glycosaminoglycans in synovial joint" ppsx

Báo cáo y học: "Relaxin''''s induction of metalloproteinases is associated with the loss of collagen and glycosaminoglycans in synovial joint" ppsx

... calculated from the ratio of the stained area to the total area in each section The average of the 10 values for each half disc was used for analysis Determination of GAG synthesis by 35S radiolabeling ... were analyzed by an examiner blinded to the hormone treatment The stained discs were videodigitized and analyzed with a software program that automatically outlined the total and Safranin-O-stained ... of these proteinases to the changes in collagen and glycosaminoglycan (GAG) content in fibrocartilaginous disc explants Our findings are consistent with the hypothesis that relaxin-mediated induction...

Ngày tải lên: 09/08/2014, 06:22

11 488 0
Báo cáo y học: "Risk factors associated with the loss of cartilage volume on weight-bearing areas in knee osteoarthritis patients assessed by quantitative magnetic resonance imaging: a longitudinal study" pot

Báo cáo y học: "Risk factors associated with the loss of cartilage volume on weight-bearing areas in knee osteoarthritis patients assessed by quantitative magnetic resonance imaging: a longitudinal study" pot

... display radiological evidence of OA of the affected knee on a radiograph obtained within months of the outset of the study Finally, patients had to have a minimum joint space width (JSW) of the ... was on the medial section On the tibial plateaus, the maximum loss was found on the medial plateau and was approximately 35% greater than that found on the lateral plateau Plateau subregion analysis ... subchondral bone marrow hypersignal, particularly in the lateral compartment There was also a correlation between the loss of cartilage in the medial central femoral condyle and the presence of lateral...

Ngày tải lên: 09/08/2014, 10:20

11 518 0
w