acetobutylicum identification of a new cell type

Báo cáo y học: "Plastic architecture of bacterial genome revealed by comparative genomics of Photorhabdus variants" ppsx

Báo cáo y học: "Plastic architecture of bacterial genome revealed by comparative genomics of Photorhabdus variants" ppsx

... analysis SG analyzed sequence data SG wrote the paper with contributions from AG and EJ-B Additional data files The following additional data files are available with this paper Additional data ... colonial variant Bacteria obtained at the end of the exponential phase were injected into fourth-instar larvae Mortality values are based on data obtained after injection into 20 larvae All experiments ... phase variation Phase variation is an adaptive process by which certain bacteria within a bacterial subpopulation, called phase variants, undergo frequent and reversible phenotypic changes Phase...

Ngày tải lên: 14/08/2014, 20:22

15 232 0
Tiểu luận tiếng anh : Robinson Crusoe – A Representative of the English Bourgeoisie in the early 18th century

Tiểu luận tiếng anh : Robinson Crusoe – A Representative of the English Bourgeoisie in the early 18th century

... misfortune as a castawy on a desert island for more than 28 years To the end of the novel, Defoe repainted a true merchant Robinson The hero started a new trading voyage He had now a vast capital of “ ... for sheep-raising and wood-making industries They had to join the force of cheap labor and working in such factories England became a typical example of initial accumulation of capitalism Holding ... Christian doctrine, he was able to change him from cannibalism to a real Christian man who believed in God Master servant relationship in “ Robinson Crusoe” can also be seen as a relation of capitalism...

Ngày tải lên: 26/11/2012, 12:02

15 2,3K 13
báo cáo hóa học:" Phase I/II open-label study of the biologic effects of the interleukin-2 immunocytokine EMD 273063 (hu14.18-IL2) in patients with metastatic malignant melanoma" docx

báo cáo hóa học:" Phase I/II open-label study of the biologic effects of the interleukin-2 immunocytokine EMD 273063 (hu14.18-IL2) in patients with metastatic malignant melanoma" docx

... had adequate organ function Patients were enrolled at least weeks after their last dose of prior therapy Patients were to have at least melanoma lesions (other than a target lesion) available ... commercial research grants from Novartis and Bayer/Onyx, served on Advisory Boards for Novartis, Antigenics, Schering and Medarex AK and OK are employees of Merck KGaA; OK is also an Adjunct Professor ... to evaluate the possibility of decrease of MHC expression as means of tumor escape There was a trend towards increase in intratumoral CD3+ T cells and CD8+ T cells in most cases examined (Table...

Ngày tải lên: 18/06/2014, 15:20

11 674 0
Lời bài hát Rhythm Of The Rain

Lời bài hát Rhythm Of The Rain

... to the rhythm of the falling rain Telling me just what a fool I've been I wish that it would go and let me cry in vain And let me be alone again Hãy lắng nghe nhịp điệu tiếng m a rơi Nó bảo tôi ... thêm lần Oh, listen to the falling rain Pitter pater, pitter pater Oh, oh, oh, listen to the falling rain Pitter pater, pitter pater Ô, lắng nghe nhịp điệu tiếng m a rơi Tí tách, tí tách Ô, ô, ... pater Ô, lắng nghe nhịp điệu tiếng m a rơi Tí tách, tí tách Ô, ô, ô, lắng nghe nhịp điệu tiếng m a rơi Tí tách, tí tách ...

Ngày tải lên: 03/12/2015, 13:07

2 281 0
Báo cáo y học: "Multivariate explanatory model for sporadic carcinoma of the colon in Dukes’ stages I and IIa"

Báo cáo y học: "Multivariate explanatory model for sporadic carcinoma of the colon in Dukes’ stages I and IIa"

... [20] Sample size was taken into account [21] A first analysis was made on the “raw” data package The selection of variables was always backward In the variables in which lost information surpassed ... for its later statistical analysis, and the quality controls were also made at this stage Statistical analysis An initial study was made on the set of records to obtain centralization and dispersion ... moment of the construction of the data package The fundamental cause was the lack of fulfilment of the inclusion criteria The assembly of the previous data package with a total of 93 records (53 cases...

Ngày tải lên: 03/11/2012, 11:34

8 560 0
Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf

Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf

... Israel/Palestine Syria Iran Lebanon Jordan Italy Korea South Africa Ireland Iraq Pakistan Turkey Argentina Egypt/United Arab Rep Taiwan England Cuba Venezuela Canada United Kingdom, ns Romania ... Poland India France Germany Portugal Brazil Hong Kong Ukraine Other USSR/Russia Japan China Vietnam Nigeria Colombia Thailand Nicaragua Peru Ecuador Trinidad and Tobago Guyana/British Guiana Jamaica ... Mexico India Korea Cuba China Vietnam Canada Iran Philippines Poland Italy Colombia Taiwan Germany El Salvador Pakistan England Greece Brazil Israel/Palestine Dominican Republic Jamaica Other USSR/Russia...

Ngày tải lên: 18/02/2014, 00:20

37 436 0
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx

... pS A A A A A A A A A A A P – pS P P P P A A – P A S A A A P A A A A A A A mK K K K K aK – A A A A A A A K K K K K K amK A A P A A A R K K K K K K pS A A A A A A pS T T T T T T T K K K K K K A ... a- T a- pS a- pS a- S a- pS a- pS N pT A T pT pT pS A A A A A A A A A A E aK S A P P P – aK aK 2mK K K – P A pT pT pS – aK K K K K – mK K K K K K A mK T K K K K R R R mR S K a ⁄ mK a ⁄ mK mK mK D A ... a- S a- pS N T T T T T S V A A A A A A A A A E – S A P P P – K aK aK aK aK – P A pT pT pS – aK K K K K – K K K K K K P A K A K K K R R R R S K aK aK aK K D A pS pS pS T S S S S S S A Q auK auK auK...

Ngày tải lên: 18/02/2014, 08:20

13 633 0
Tài liệu Báo cáo khoa học: The localization of FGFR3 mutations causing thanatophoric dysplasia type I differentially affects phosphorylation, processing and ubiquitylation of the receptor pptx

Tài liệu Báo cáo khoa học: The localization of FGFR3 mutations causing thanatophoric dysplasia type I differentially affects phosphorylation, processing and ubiquitylation of the receptor pptx

... severe phenotype called severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN) [12], whereas replacement of lysine by asparagine or glutamine (K650N ⁄ Q) is associated with ... The thanatophoric dysplasia type II mutation hampers complete maturation of fibroblast growth factor receptor which activates signal transducer and activator of transcription from the endoplasmic ... Stewart AK (2004) Preclinical studies of fibroblast growth factor receptor as a therapeutic target in multiple myeloma Br J Haematol 124, 595–603 38 Maeda T, Yagasaki F, Ishikawa M, Takahashi N...

Ngày tải lên: 19/02/2014, 00:20

16 573 0
Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc

Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc

... observation is easily explained by the fact that a nonsaturating concentration of DCMU was used, meaning that only a fraction of the PSII reaction center was affected by DCMU Then, the intact fraction ... untreated thylakoids incubated at the maximal and minimal temperaTable Quantitative analysis of uorescence induction (FI) in spinach thylakoids at 21 C FI traces were tted with three exponential ... particular, the characteristics of the JI phase are almost impossible to determine from visual analysis of the traces It was shown that the three phases can be quantitatively resolved using a sum of...

Ngày tải lên: 19/02/2014, 05:20

8 712 0
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx

... exon, and 25 bp of the 3Â exon Oligo 104 (45 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in order, a T7 RNA polymerase promoter (nucleotides 117), a six-nucleotide transcription ... cleavage of 23S.5DGb pre-RNA, and quantication %Preịt A expka tị ỵ B expkb tị A and ka are the percentage and observed rate constant for the fast-reacting pre-RNA, and B and kb are the same ... RNA cleaved with Mn2+ at GAAA sequences (nucleotides 56, 257 and 323); A, G, A U, and C, enzymatic sequence ladder of S RNA; OH, partial alkaline hydrolysis of S RNA; and M, 5Â end-labeled DNA...

Ngày tải lên: 19/02/2014, 07:20

14 480 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... assembly of an active mammalian mitochondrial complex I Experimental procedures Cell lines and cell culture The isolation and preliminary biochemical and genetic characterization of a series of respiration-deficient ... MWFE.HA in the same human cells It appears that the heterologous ESSS is stable and accumulated to a significant level Mitochondria from the same cells were also analyzed by BN/PAGE No hamster...

Ngày tải lên: 19/02/2014, 16:20

9 623 0
Tài liệu Báo cáo khoa học: Phylogenetic relationships in class I of the superfamily of bacterial, fungal, and plant peroxidases pptx

Tài liệu Báo cáo khoa học: Phylogenetic relationships in class I of the superfamily of bacterial, fungal, and plant peroxidases pptx

... Catalase–peroxidase Ascorbate peroxidase (thylakoid) Ascorbate peroxidase Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase ... Catalase–peroxidase Catalase HPI Catalase–peroxidase Ascorbate-dependent peroxidase Catalase–peroxidase Ascorbate peroxidase Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase Ascorbate ... Catalase–peroxidase Catalase–peroxidase Catalase I Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase Cytochrome c peroxidase Ascorbate peroxidase Peroxidase/catalase Ascorbate peroxidase Ascorbate peroxidase...

Ngày tải lên: 19/02/2014, 16:20

13 512 0
Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx

Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx

... also are likely to participate in the establishment and maintenance of an active chromatin state [18,28,29] In addition to their presence in and adjacent to active or potentially active genes, cell ... 9210 and image quant (Amersham Biosciences, Piscataway, NJ, USA) Acetylation status of H3 and H4 histones was examined by chromatin immunoprecipitation (ChIP) and real-time PCR (R-PCR) as described ... recombinant clones by PCR and tamoxifen treatment To determine homologous recombination, PCR was carried out as described [45] using the following primers: 5¢CGATTGAAGAACTCATTCCACTCAAATATACCC-3¢ (in Bsr...

Ngày tải lên: 19/02/2014, 16:20

11 639 0
Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx

... domain GST (s) or GST (m) are shown Background binding of cells to BSA was substracted The data is presented as a percentage of attached cells The amounts of bound and added red cells were quantitated ... ICAM L cell transfectants and low background binding of wild -type L cells After substraction of background binding, approximately 30% of the total added ICAM-1 L cells adhered to the I domain of ... Inhibition of adhesion of ICAM transfectants to purified CD1 1a I domain GST fusion protein The effects of anti-ICAM and anti-I domain mAbs on adhesion of ICAM transfectants to 0.4 lg of I domain GST captured...

Ngày tải lên: 20/02/2014, 11:20

14 495 0
Tài liệu Báo cáo Y học: Role of electrostatics in the interaction between plastocyanin and photosystem I of the cyanobacterium Phormidium laminosum ppt

Tài liệu Báo cáo Y học: Role of electrostatics in the interaction between plastocyanin and photosystem I of the cyanobacterium Phormidium laminosum ppt

... cyanobacteria and algae: an instance of unusual genetic-variability Biochim Biophys Acta 766, 310–316 ´ Balme, A. , Hervas, M., Campos, L .A. , Sancho, J., De la Rosa, M .A & Navarro, J .A (2002) A ... interaction of plastocyanin with photosystem I in Anabaena [15], and is highly conserved in cyanobacterial plastocyanins Mutagenesis, expression, purification and characterization of the plastocyanins ... 14 Hervas, M., Navarro, J .A. , Dı´ az, A & De la Rosa, M .A (1996) A comparative thermodynamic analysis by laser-flash absorption spectroscopy of photosystem I reduction by plastocyanin and cytochrome...

Ngày tải lên: 21/02/2014, 01:21

10 674 0
Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx

Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx

... C3 5A, C35AF and C35AR; c550 C3 8A, C38AF and C38AR; c550 C35AC3 8A, C35AC38AF and C35AC38AR H thermophilus cytochrome c552 and its AXXCH, AXXAH and CXXAH variants were expressed from the plasmids ... of its signal peptide is approximately kDa, whereas the uncleaved product has a mass of approximately 11 kDa Maturation of single-cysteine holocytochromes There are natural examples of cytochromes ... of periplasmic fractions or heme staining of appropriate SDS-PAGE gels System II mediates the formation of a b -type cytochrome Unexpectedly, the spectra of periplasmic extracts of cells containing...

Ngày tải lên: 06/03/2014, 09:22

12 469 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

... 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCG ... 5¢-TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢ The two amplified fragments were used as a combined template for the tertiary amplification, ... GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ (His-tag underlined); PSAG with a C-terminal Strep-tag (PSI-G-StrepTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT...

Ngày tải lên: 07/03/2014, 21:20

9 422 0
Báo cáo Y học: Characteristics of binding of insulin-like growth factor (IGF)-I and IGF-II analogues to the type 1 IGF receptor determined by BIAcore analysis pptx

Báo cáo Y học: Characteristics of binding of insulin-like growth factor (IGF)-I and IGF-II analogues to the type 1 IGF receptor determined by BIAcore analysis pptx

... calculation of kd/ka, where ka is the association rate and kd is the dissociation rate Relative Kd is equal to Kd of IGF-I/Kd of IGF analogue Dashes indicate data inappropriate for assessing association ... fragmentation Survival assays (MTT-based assay) and DNA fragmentation ELISAs were performed as described in Materials and methods, and the data are presented as means ‹ SD from at least three independent ... surfaces cell survival assays and an apoptotic DNA fragmentation ELISA PC12 cells cultured in complete serum are fully viable and actively proliferate Deprivation of serum (24 h) induces 47.5% apoptosis...

Ngày tải lên: 08/03/2014, 22:20

8 482 0
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

... recombinant allergen after affinity purification using the mAb IG12 [18] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage site after incubation ... enables expansin activation, accumulation and catalysis under identical pH conditions and explains how expansins may mediate acid growth of plant cell walls Theoretical pI calculations show that ... supernatant containing rPhl p N showed strong degradation of the full-length allergen and accumulation of a truncated  15-kDa fragment at about pH 4.5 (Fig 3A) This sharp band lacked the N-terminal...

Ngày tải lên: 08/03/2014, 22:20

10 535 0
w