abc transporters aldehyde dehydrogenase and adult stem cells

Báo cáo y học: "Comparative transcriptome analysis of embryonic and adult stem cells with extended and limited differentiation capacity" pps

Báo cáo y học: "Comparative transcriptome analysis of embryonic and adult stem cells with extended and limited differentiation capacity" pps

Ngày tải lên : 14/08/2014, 08:20
... [1,2] Other adult stem cells include neural stem cells (NSCs) [3], and the mesenchymal stem cells (MSCs) that give rise to osteoblasts, chondrocytes, adipocytes, and skeletal and smooth muscle ... marrow stem cells (hBMSC), marrow-isolated adult multilineage inducible (MIAMI) cells, and pre-MSCs), umbilical cord blood (unrestricted somatic stem cells (USSCs)), placenta, muscle, and other ... neural stem cells Science 2000, 287:1433-1438 Prockop D: Marrow stromal cells as stem cells for nonhematopoietic tissues Science 1997, 276:71-74 Smith AG: Embryo-derived stem cells: of mice and...
  • 20
  • 301
  • 0
Báo cáo hóa học: " Nutraceutical augmentation of circulating endothelial progenitor cells and hematopoietic stem cells in human subjects" potx

Báo cáo hóa học: " Nutraceutical augmentation of circulating endothelial progenitor cells and hematopoietic stem cells in human subjects" potx

Ngày tải lên : 18/06/2014, 16:20
... growth factor stimulated and not stimulated cells was calculated and compared for different periods before and after intervention Stem- Kine mobilizes CD34 and CD133 Cells Statistics Differences ... single-blinded, dose-escalation clinical trial Stem Cells 2009, 27(11):2857-64 Keller LH: Bone marrow-derived aldehyde dehydrogenase- bright stem and progenitor cells for ischemic repair Congest Heart ... human stem cells Stem Cells Dev 2006, 15(1):118-23 77 Shytle RD, Ehrhart J, Tan J, Vila J, Cole M, Sanberg CD, Sanberg PR, Bickford PC: Oxidative stress of neural, hematopoietic, and stem cells: ...
  • 10
  • 665
  • 0
Báo cáo y học: "Endogenous and exogenous stem cells: a role in lung repair and use in airway tissue engineering and transplantation" pdf

Báo cáo y học: "Endogenous and exogenous stem cells: a role in lung repair and use in airway tissue engineering and transplantation" pdf

Ngày tải lên : 10/08/2014, 05:21
... Therefore, the exogenous stem/ progenitor cells, such as embryonic stem cells (ESCs), bone marrowor fat-derived mesenchymal stem cells (MSCs), and recently amniotic fluid stem/ progenitor cells, could be ... fluid stem cells can integrate and differentiate into epithelial lung lineages Stem Cells 2008, 26:2902-2911 Takahashi K, Yamanaka S: Induction of pluripotent stem cells from mouse embryonic and adult ... population of endothelial cells resistant to bronchiolar and alveolar damages and which is capable of giving rise, not only to Clara cells, but also to type I and type II alveolar cells in vitro was...
  • 9
  • 487
  • 0
Adult Stem Cells full bản đẹp

Adult Stem Cells full bản đẹp

Ngày tải lên : 24/08/2016, 10:25
... include cloned cells, embryonic or fetal stem cells, or adult stem cells Although each of these sources of stem cells has potential biological advantages and disadvantages, ethical and legal concerns ... cloning (1–4) and the use of embryonic and fetal stem cells (5) Adult stem cells might provide medical solutions that avoid the ethical and legal problems of cloning and fetal stem cell approaches ... emerging on adult stem cells Much of the public attention and debate has been focused on the possibility that adult stem cells may be used as a substitute for human embryonic stem cells or as...
  • 361
  • 381
  • 0
Báo cáo toán học: "Adult neurogenesis, neuroinflammation and therapeutic potential of adult neural stem cells" ppsx

Báo cáo toán học: "Adult neurogenesis, neuroinflammation and therapeutic potential of adult neural stem cells" ppsx

Ngày tải lên : 08/08/2014, 17:20
... human biopsies and post-mortem tissues [35] It is hypothesized that newborn neuronal cells in the adult brain originate from residual stem cells The existence of stem cells in the adult brain suggests ... self-repair and that newborn neuronal cells may contribute to the functioning, and physioand pathology of the CNS [36] However, adult NSCs remain elusive cells and to be unequivocally identified and ... neural progenitor and stem cells [39] Self-renewing multipotent neural progenitor and stem cells have been isolated and characterized in vitro, from various regions of the adult mammalian CNS,...
  • 6
  • 232
  • 0
Báo cáo y học: "Adult mesenchymal stem cells and cell-based tissue engineering" doc

Báo cáo y học: "Adult mesenchymal stem cells and cell-based tissue engineering" doc

Ngày tải lên : 09/08/2014, 01:21
... engineering and regeneration [134] Mesenchymal stem cells versus embryonic stem cells Embryonic stem (ES) cells are derived from the inner cell mass of the embryonic blastocyst These cells can ... ‘bone marrow stem cell’, which is often used for either hematopoietic or mesenchymal stem cells, the central nervous system stem cell, the hepatic stem cell, etc.? If many stem cells are found ... supports the survival and differentiation of stem cells These complementary approaches have been used to compare different groups of stem cells in order to identify core stem genes and to examine...
  • 14
  • 347
  • 0
Báo cáo y học: "Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation" potx

Báo cáo y học: "Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation" potx

Ngày tải lên : 09/08/2014, 10:20
... Adult mesenchymal stem cells: characterization, differentiation, and application in cell and gene therapy J Cell Mol Med 2004, 8:301-316 31 Tuan RS, Boland G, Tuli R: Adult mesenchymal stem cells ... markers and pulse–chase techniques can be used to label stem cells [79] In other systems, asymmetric division has been shown to be integral to stem cell self-renewal This unique property of stem cells ... multipotent adipose-derived stem cells Stem Cells 2006, 24:2412-2419 Kleber M, Sommer L: Wnt signaling and the regulation of stem cell function Curr Opin Cell Biol 2004, 16:681-687 Boland GM, Perkins G,...
  • 10
  • 526
  • 0
Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"

Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"

Ngày tải lên : 25/10/2012, 11:18
... searchers have transplanted the bone marrow stem cells into the necrotic femoral heads, and results show bone marrow stem cells can remove vascular lesions and promote angiogenesis in necrotic femoral ... [19-21] Recently, in order to improve the efficacy of stem cell transplantation, committed stem cells are isolated and purified, and single lineage stem cell transplantation is then performed Deng ... expressed in injured tissues play important roles (2) Stem cells circulate among tissues, and stem cells migrate to the injured tissues once injury occurs Stem cell homing is a complicated process in...
  • 10
  • 584
  • 0
Tài liệu Báo cáo khoa học: Loose interaction between glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase revealed by fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy in living cells doc

Tài liệu Báo cáo khoa học: Loose interaction between glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase revealed by fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy in living cells doc

Ngày tải lên : 16/02/2014, 09:20
... of subunits O and P, subunits O and Q and subunits O and R are shown (B–D) FLIM analysis of the interaction between cerulean–GAPDH and citrine–GAPDH in living CHO-K1 cells CHOK1 cells were transfected ... (Roche, Basel, Switzerland) Cells were incubated for 40 h after transfection and observed with a FLIM microscope Immunofluorescence staining HeLa cells were fixed with 3% formaldehyde and immunostained ... Subcellular localization and enzymatic activities of GAPDH– citrine and PGK–cerulean (A) Expression of GAPDH–citrine and PGK–cerulean Localization of endogenous GAPDH and PGK in HeLa cells was examined...
  • 9
  • 586
  • 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Ngày tải lên : 18/02/2014, 04:20
... adult human mesenchymal stem cells Science 284, 143–147 Porada CD, Zanjani ED & Almeida-Porad G (2006) Adult mesenchymal stem cells: a pluripotent population with multiple applications Curr Stem ... mesenchymal stem cells and mononuclear cells Stem Cells 25, 1166–1177 Li L, Zhang S, Zhang Y, Yu B, Xu Y & Guan Z (2009) Paracrine action mediates the antifibrotic effect of transplanted mesenchymal stem ... TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin (a-SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢...
  • 11
  • 653
  • 0
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

Ngày tải lên : 07/03/2014, 12:20
... ES cells and in human hematopoietic progenitor cells Discussion B Fig Transcription of LCR hypersensitive site in undifferentiated murine embryonic stem cells and in human CD 133+ bone marrow cells ... Levings et al density of 105 cells well)1 The cells were passaged again and reseeded on day On days 0, 5, 8, 10 and 12, cells were collected and subjected to RT-PCR and ⁄ or ChIP analysis Globin ... structure modifications and factor recruitment at the murine b-globin locus in uninduced embryonic stem cells (day 0), as well as that of primitive and definitive erythroid cells (days and 12, respectively)...
  • 10
  • 422
  • 0
Stem CELLS and the FUTURE OF REGENERATIVE MEDICINE pdf

Stem CELLS and the FUTURE OF REGENERATIVE MEDICINE pdf

Ngày tải lên : 15/03/2014, 09:20
... PROJECT OVERVIEW AND DEFINITIONS ADULT STEM CELLS 19 EMBRYONIC STEM CELLS 31 OPPORTUNITIES FOR AND BARRIERS TO PROGRESS IN STEM CELL RESEARCH FOR REGENERATIVE MEDICINE 41 FINDINGS AND RECOMMENDATIONS ... between adult and embryonic stem cells and among adult stem cells found in different types of tissue The implications of these biological differences for therapeutic uses are not yet clear, and additional ... embryonic and adult human stem cells will be required to most efficiently advance the scientific and therapeutic potential of regenerative medicine Research on both adult and embryonic human stem cells...
  • 112
  • 628
  • 0
Stem Cells in Human Reproduction Basic Science and Therapeutic Potential Second Edition pot

Stem Cells in Human Reproduction Basic Science and Therapeutic Potential Second Edition pot

Ngày tải lên : 22/03/2014, 20:21
... Properties and Potential Benefits of Human Embryonic Stem Cells and Wharton’s Jelly Stem Cells 136 Chui-Yee Fong, Kalamegam Gauthaman, and Ariff Bongso 14 Amniotic Fluid and Placenta Stem Cells 150 ... Atala 15 Adult Stem Cells in the Human Endometrium 160 ´, ´n Caroline E Gargett, Irene Cervello Sonya Hubbard, and Carlos Simo 16 Stem Cell Populations in Adult Bone Marrow: Phenotypes and Biological ... human male germ cells from bone marrow stem cells Soc Reprod Fertil Suppl 2007; 63:69–76 36 Takahashi K, Yamanaka S Induction of pluripotent stem cells from mouse embryonic and adult fibroblast...
  • 273
  • 510
  • 0
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc

Ngày tải lên : 30/03/2014, 04:20
... mesenchymal stem cells (AT-MSCs) differentiate into hepatocyte-like cells upon treatment with hepatocyte growth factor (HGF), oncostatin M and dimethyl sulfoxide [13] These cells expressed albumin and ... mesenchymal stem cells of fetal or maternal origin from human placenta Stem Cells 22, 1338–1345 Bieback K, Kern S, Kluter H & Eichler H (2004) Critical parameters for the isolation of mesenchymal stem cells ... Huang CT, Tsai CC, Shen EY & Chiu WT (2005) Isolation and characterization of neurogenic mesenchymal stem cells in human scalp tissue Stem Cells 23, 1012–1020 In’t Anker PS, Scherjon SA, Kleijburg-van...
  • 14
  • 597
  • 0
Neural Stem Cells and Therapy Edited by Tao Sun potx

Neural Stem Cells and Therapy Edited by Tao Sun potx

Ngày tải lên : 30/03/2014, 23:20
... (slowly dividing astroglial cells and the bona fide adult neural stem cells) , type C cells (transit-amplifying cells derived from asymmetric division of Type B cells) , type A cells (immature neuroblasts ... history and the most advanced discoveries in neural stem cells This book provides the strategies and challenges of utilizing neural stem cells for therapy of neurological disorders and brain and ... Bian and Tao Sun Part Neural Stem Cells and Therapy 257 Chapter 13 Neural Stem/ Progenitor Cell Clones as Models for Neural Development and Transplantation 259 Hedong Li, He Zhao, Xiaoqiong Shu and...
  • 452
  • 381
  • 0
Báo cáo Y học: Effect of coenzymes and thyroid hormones on the dual activities of Xenopus cytosolic thyroid-hormone-binding protein (xCTBP) with aldehyde dehydrogenase activity potx

Báo cáo Y học: Effect of coenzymes and thyroid hormones on the dual activities of Xenopus cytosolic thyroid-hormone-binding protein (xCTBP) with aldehyde dehydrogenase activity potx

Ngày tải lên : 31/03/2014, 21:21
... several dehydrogenases: pig heart malic dehydrogenase [34], beef liver glutamic dehydrogenase [34–36], pig heart malate dehydrogenase [37], horse and human alcohol dehydrogenases [38–40] and human aldehyde ... Yamauchi and J Nakajima (Eur J Biochem 269) Fig Photoaffinity-labeling of xCTBP/xALDH1 in Xenopus cells Xenopus cytosol from KR cells (lane 1), XL58 cells (lane 2) and adult liver (lane 3), and the ... KR and XL58 cells revealed, via autoradiography, a labeled protein band of the same size (lanes and in Fig 6), demonstrating that xCTBP/ xALDH1 is capable of binding T3 within the Xenopus cells...
  • 8
  • 405
  • 0
Tế bào gốc và ứng dụng trong y sinh học (Stem cells and the application in biomedicine) potx

Tế bào gốc và ứng dụng trong y sinh học (Stem cells and the application in biomedicine) potx

Ngày tải lên : 02/04/2014, 22:20
... novel circulating human embryonic blood stem cells Blood 96, 1740 - 1747 IItskovitz - Eldor, J and et al (2000).; Differentiation of human embryonic stem cells into embryoid bodies comprising the ... human pancreatic cell line in vitro and in vivo Mol Endocrinol 15, 476 - 483 Dzierzak, E et al (1998); Embryonic beginnings of definitive hematopoietic stem cells Ann N Y Acad Sci 872, 256 - 262 ... 814 - 822 Jones, G M., et al (2000); Human embryonic stem cells technology Semin Reprod Med 18, 219 - 223 Orlic D et al (2001); Bone marrow cells regenerate infarcted myocardium nature 410, 701...
  • 14
  • 757
  • 2
embryonic stem cells, methods and protocols - kursad turksen

embryonic stem cells, methods and protocols - kursad turksen

Ngày tải lên : 08/04/2014, 12:51
... Studying Stem Cells and Progenitors Jane E Aubin, Fina Liu, and G Antonio Candeliere 403 30 Nonradioactive Labeling and Detection of mRNAs Hybridized onto Nucleic Acid cDNA Arrays Thorsten Hoevel and ... (ES cells to inject and cells to pellet for DNA) into the microfuge and spin for at 110g To make sure trypsin is removed, aspirate the supernatant and add mL M2 to the cells for injection and ... something for both experts and novices alike, that it will serve as a launching point for further developments in stem cells, and that we will all-too-soon wish to expand and update it with other...
  • 516
  • 553
  • 0
neural stem cells. methods and protocols

neural stem cells. methods and protocols

Ngày tải lên : 11/04/2014, 09:58
... Alvarez-Buylla, A and Lois, C (1995) Neuronal stem cells in the brain of adult vertebrates Stem Cells 13, 263–272 Production and Analysis of Neurospheres 27 Gage, F., Ray, J and Fisher, L (1995) ... “Isolation and Culture of Neural Stem Cells introduces the reader to different sources of stem/ progenitor cells and provides a wide range of conditions for their selection, nourishment, growth and ... “Utilization/Characterization of Neural Stem Cells in vivo,” is a collection of techniques to identify and characterize endogenous stem cells as well as exogenous stem cells after transplantation into...
  • 371
  • 365
  • 0
liver stem cells methods and protocols

liver stem cells methods and protocols

Ngày tải lên : 29/05/2014, 17:06
... of stem cells in repair of liver injuries Several types of stem cells, such as embryonic stem (ES) cells, induced pluripotent stem (iPS) cells, haematopoietic stem cells, and mesenchymal stem cells, ... liver stem/ progenitor cells exist in normal adult liver Recently, we and others have successfully identied oval cells and adult liver stem/ progenitor cells Here, we describe the identication and ... formation from stem cells; (4) Liver stem cells and hepatocarcinogenesis; and (5) Application of liver stem cells for cell therapy All these current topics shed light on stem cell technology...
  • 226
  • 812
  • 0