a wap in escherichia coli

... tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG AGGATGACGA ... ttcagacctg ttcagacctg 40 41 ttattatggg tattacttta tctgatgatt ctgaTcatca 80 81 Gtttttgctt ggatcccagg ttgttgtaca gaatgctggt 120 121 catatgagcg gcagcgatgg cggcgtgtgc cgaaaattct 160 161 gaaaaaatgc ... cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320...

Ngày tải lên: 12/02/2014, 10:20

... whereas phosphorylated EIIA activates adenylate cyclase (CyaA) and leads to an increase in the intracellular cyclic AMP (cAMP) level [1] Mathematical models of catabolite repression in E coli ... metabolites An approach that combines flux balance analysis (FBA) with an ordinary differential equation (o.d.e.) model of the slow time scales is called dynamic flux balance analysis (dFBA), and ... EIIA and B domains being part of the phosphorylation chain and the EIIC domain representing the membrane domain As all components of the PTS, depending on their phosphorylation status, can interact...

Ngày tải lên: 18/02/2014, 13:20

... i.e a mass of 28 Da y-Type fragments are C-terminal [28] Probably due to a loss of NH3 from asparagine, many fragments show a satellite peak at )17 Da Fragments bearing a glucosyl moiety are marked ... metabolized by a complex pathway that includes the action of amylomaltase (malQ), maltodextrin phosphorylase (malP) and maltodextrin glucosidase (malZ) [33] It is not inconceivable that a similar ... generated by either in- gel trypsination or by cyanogen bromide cleavage and subsequent a- amylase treatment were separated by RP-HPLC (SMART system, Pharmacia, Uppsala, Sweden) on a Pharmacia C2/C18...

Ngày tải lên: 19/02/2014, 16:20

... lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of ... was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter region is provided in...

Ngày tải lên: 06/03/2014, 01:20

... transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial strains and plasmids ... immunoprecipitated with antisera directed against P48 and TF, analyzed on SDS/ PAGE and visualized with a PhosphorImager (B) Quantification of data presented in panel (A) , after correction for translation ... generate truncated mRNA, plasmids (Table 1) encoding truncated nascent chains were linearized and transcribed as described previously [13] The resulting mRNAs were translated in vitro in a lysate...

Ngày tải lên: 08/03/2014, 09:20

... enzyme that plays a significant role in brain metabolism, where L-pipecolate acts as a neuromodulator DAAO has been proposed to regulate the levels of D-serine in brain, a D-amino acid that modulates ... produced in E coli was purified as a holoenzyme with spectral properties typical of the flavin-containing oxidases (absorbance maxima at 457 nm and 376 nm and a A274 /A4 56 ¼ 9) Native GO is a 180-kDa homotetramer, ... measured using a similar amount (5 mU) of GO, DAAO and MSOX on various substrates showed that GO and DAAO oxidize D-proline, D-alanine and D-2-aminobutyrate with similar relative efficiencies Analogously,...

Ngày tải lên: 08/03/2014, 16:20

... Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... potential coadjuvants of those antimicrobial agents that are already available after incubation for 18–20 h at 37 °C Antibacterial activity was expressed as MIC, the concentration of peptide at which ... (kmax: 405 nm), was recorded at 405 nm, using a spectrophotometer (UV-1700 Pharma Spec Shimadzu, Tokyo, Japan) An increase in absorbance results in an increase in OM permeability [31] The same amount...

Ngày tải lên: 16/03/2014, 00:20

... bacteria consist of a heat labile domain and a heat stable domain Bentahir et al [13] have proposed that a heat labile domain provides a sufficient flexibility around the active site, and a heat ... plasmids pSIB1-Cd and pSIB1 -a3 +Cd, respectively The sequences of the 5¢ PCR primers were 5¢-AGAGAGAA TTCATATGTCAGATTTGTTCAG-3¢ for N-domain+, 5¢CTGAAAACGCTAAGCATATGGGTATTACGA-3¢ for C-domain–, ... variants are schematically shown in comparison with that of the intact protein in Fig Because a long a3 helix spans both the N- and C-domains, and because the region containing only a1 and a2 ...

Ngày tải lên: 23/03/2014, 13:20

... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTGATGTGGTTCATC-3¢ (PstI-HindIII) ... CTGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAA AAGCTTAATATTGTTGTGATGTGGTTCATC-3¢ (PstIHindIII); Pfg27B: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTG TGATGTGGTTCATC-3¢ (PstI); Pfg27C: 5¢-AAAAAGC...

Ngày tải lên: 23/03/2014, 21:20

... no activity M Amblar and C M Arraiano In vitro transcription of RNAs Band-shift assays SL 9A and malE-malF RNA molecules were obtained by in vitro transcription using the pSL 9A plasmid linearized ... be a good candidate for being one of the metal ligands at the active site of 369 RNase II mutant with RNA binding but no activity M Amblar and C M Arraiano Fig Effect of EDTA in RNA binding malE-malF ... demonstrate that the single amino acid substitution Asp209fiAsn in RNase II is able to cause the total inactivation of the enzyme without affecting its RNA binding capability In addition, metal ions...

Ngày tải lên: 30/03/2014, 15:20

... models are based on different approaches such as conservation mass balance and the mass action law, and involve the use of ordinary differential equations, or stochastic kinetics in cases where ... Sankar M, Osmont KS, Rolcik J, Gujas B, Tarkowska D, Strnad M, Xenarios I, Hardtke CS: A qualitative continuous model of cellular auxin and brassinosteroid signaling and their crosstalk Bioinformatics ... features for each cluster that takes part in biofilm formation Each cluster was obtained from cluster analysis of the microarray data of the whole E coli K-12 genome Shalá et al Theoretical...

Ngày tải lên: 13/08/2014, 16:20

... plasmid pKD3 was amplified by PCR using Pwo polymerase (Roche Diagnostics GmbH, Mannheim, Germany) and primers rluD114::cat(pKD3) 5¢ (5¢-GCT ACA ATA GCA CAC TAT ATT AAA CGG CAA AGC CGT AAA ACC ... TGT AGG CTG GAG CTG CTT CG3¢) and rluD114::cat(pKD3) 3¢ (5¢-GAC CAG ATT AAT GTG AAA AGA AAA TCA CGC GTA CCG GAT CGT CTT GAT GGG AAT TAG CCA TGG TCC-3¢) (complementary regions to the rluD-flanking ... U1 (CAG CCT GGC CAT CAT TAC GCC) and AMV reverse transcriptase (Seikagaku Corp., Tokyo, Japan) in the presence of [a- 32P]dCTP (Amersham Biosciences, Piscataway, NJ, USA) The resulting DNA fragments...

Ngày tải lên: 18/02/2014, 16:20

... 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG ... 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO ... Forward Reverse Forward Reverse Reverse Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG...

Ngày tải lên: 19/02/2014, 16:20

... (5¢-TAGTTCCCCGGGGGTGAAGCTGA AGTTTCTCTGACCGGTCAGCCGTTC-3¢) and reverse primer tsf-DOWNS (5¢-AGTCAGGATCCGTCGACA GAGCTTCGCCACTCAACTTAAGCAGAA-3¢) Like primer Ts185, Ts224 contains a unique AvaI restriction ... forward primer pT711 (5¢-TAATACGACTCACTATAGGGGA ATTG-3¢) and reverse primer Int R (5¢-CCCATGACCT TATTACCAACCTC-3¢), respectively The final amplified fragment was digested with XbaI and KpnI and inserted ... studies have shown that mutations in EF-Tsmt, which cause a weakening in the interaction with E coli EF-Tu, correlate with an increased ability to stimulate GDP exchange as well as an increased activity...

Ngày tải lên: 21/02/2014, 00:20

... dehydratase Lipoamide dehydrogenase Cobalamin-indepd methionine synthase Cobalamin-depd methionine synthase Alkaline phosphatase Inorganic pyrophosphatase Phosphotransacetylase RNA polymerase a subunit ... zinccontaining proteins, Fba (fructose-1,6-bisphosphatase aldolase), LpdA (lipoamide dehydrogenase), Ppa (inroganic pyrophosphatase), Pta (phosphotransacetylase) and RpoA (RNA polymerase a subunit) ... stained band intensity was measured with LAS-1000 image analyser (Fuji Film Co., Japan) Sp1 was kindly donated by Y Sugiura (Kyoto University, Japan) RESULTS Zinc-binding assay of total E coli...

Ngày tải lên: 22/02/2014, 04:20

... solution and under vacuum After washing with ice-cold buffer solution the filters were placed in vials containing scintillation cocktail (Quicksafe A, Zinsser Analytic, Frankfurt/Main, Germany) The radioactivity ... transport Function of a newly introduced intrahelical salt bridge on sensing The E coli UhpT protein exhibits an intramolecular salt bridge located in transmembrane domain 11 [25] that appears ... can be transported by a molecule that is locked in the inducing conformation and which argues against the transport of Glc6P causing an inducing conformation For UhpC and other membrane proteins...

Ngày tải lên: 08/03/2014, 08:20

... (chii gach chan) voi trinh tu tihu sau: Moi ha5-0f: tccatggatgagaaaatagtgcttcttc; Moi ha5-0r: taagcttaatgcaaattctgcattg Cac phuang phap ve sinh hgc phan tu nhu cat, noi cac doan gen, bien nap plasmid ... a minor isoleucyl tRNA on heterologous protein translation va Escherichia coli J Bacterial 177(24): 70867091 Ghendon YZ, Markushin SG, Akopova II, Koptiaeva IB, Nechaeva EA,Mazurkova LA, Radaeva ... qUa tren hinh va cho thay, tren duang chay cua cac cac dong te bao mang plasmid tai to hgp xuat hien mgt protein la co kich thuac khoang 66 kDa, tuong duang vai kich thuac du doan cua protein...

Ngày tải lên: 11/03/2014, 08:20

... Laboratories Inc (Palo Alto, CA, USA); anti-penta-His monoclonal antibody from Qiagen Inc.; and alkaline phosphatase-conjugated rabbit anti-mouse Ig(G + A + M) from Zymed Laboratories Inc (San ... phosphate and nitroblue tetrazolium (Nakarai, Kyoto, Japan) N-terminal amino acid sequencing N-terminal amino acid sequences were determined after separation of the recombinant proteins by SDS-PAGE ... form and chimeric form of GluV8 The DNA fragment encoding the full-length form of GluV8 (Met1-Ala336) was amplified with a pair of primers (5¢ATGGGATCCAAAGGTAAATTTTTAAAAGTTAGTT CT-3¢ and 5¢-ATTGGATCCCTGAATATTTATATCAGG...

Ngày tải lên: 16/03/2014, 06:20

... Probe Acs Reverse primer Forward primer 5¢-TAATACGACTCACTATAGGGA* 5¢-AACACACCATTCCTGCCAAC-3¢ CCACCACAGGTCGCGCC-3¢ AcnB PrpD PrpE 5¢-TAATACGACTCACTATAGGGA* CGTGGTTACGCACTTCACC-3¢ 5¢-TAATACGACTCACTATAGGGA* ... D-malate and L-malate, fumarate, maleate, D-tartrate and meso-tartrate, D-citramalate and L-citramalate, mesaconate, citraconate, itaconate, and (R,S)-3-methylitaconate Cloning and characterization ... 5¢-TAATACGACTCACTATAGGGA* TCGCTGCTTCAACTGCCG-3 5¢-TAATACGACTCACTATAGGGA* GATTCCAGCCACGCCACC-3¢ 5¢-CTCACACGCTGCTGATGTTC-3¢ 5¢-AACATCGGCGCGATGATCC-3¢ 5¢-ACCGGAGCAGTTCTGGGC-3¢ Ó FEBS 2002 6188 M Brock et al (Eur...

Ngày tải lên: 17/03/2014, 10:20

... 5¢-CGAA GAAGGGCGGGGAGAAAT-3¢ +bp1870±1850, i.e 5¢TCCATAGCAGCGGCGAAACCA-3¢ and chromosomal DNA from strain LM1237 [17] as a template The PCR fragment was subsequently digested with the enzymes DraI ... which the pA1lacO-1 promoter and the lacIq1 gene are surrounded by a DNA fragment originating from upstream the topA gene and a fragment containing the N-terminal part of the topA gene Replacement ... [16] ATP/ADP assay Intracellular concentrations of ATP and ADP were measured using a luciferin±luciferase ATP monitoring kit (LKB), essentially according to the manufacturer's recommendations This...

Ngày tải lên: 18/03/2014, 01:20