a usss case study of large scale industrialized cybercrime

FINANCIAL ASSISTANCE FUNDING OPPORTUNITY ANNOUNCEMENT - Small Business Innovation Research (SBIR) pdf

FINANCIAL ASSISTANCE FUNDING OPPORTUNITY ANNOUNCEMENT - Small Business Innovation Research (SBIR) pdf

... NUMBER OF AWARDS DOE anticipates making approximately 162 awards under this FOA SBIR and STTR awards are subject to the availability of appropriated funds and this FOA does not obligate DOE to make ... funding of either basic or applied research at a DOE National Laboratory and is available for transfer to the private sector The level of technology maturity will vary and applicants are encouraged ... 17 can be found on the DOE Financial Assistance Forms and Information For Applicants and Recipients web page at http://energy.gov/management/office-management/operationalmanagement/financial-assistance/financial-assistance-forms,...

Ngày tải lên: 23/03/2014, 03:20

62 761 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The ... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation of the 5'-flanking region of genes by thermal asymmetric interlaced polymerase chain reaction...

Ngày tải lên: 26/10/2012, 10:04

7 612 1
current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

... FSoft has established FPT Software Japan, Ltd with its headquarters in Tokyo and a representative office in Osaka, Japan Following the success of FPT Software Japan, FPT Software APAC was established ... : Japanese levels of proficiency or experience LAN : Local Area Network NASDAQ : National Association of Securities Dealers Automated Quotation System NASSCOM : National Association of Software ... historical legacy that has created a greater awareness of French and English than many East Asian rivals Young Vietnamese with better English communication have already overcome the language barrier...

Ngày tải lên: 27/10/2012, 16:41

79 611 6
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

... respectful attitudes of Paley and Alvarez towards the value of life are always appreciated, especially in the contemporary age of technology, diseases and social evils, which has caused escalating ... mother had done was apparently a revenge against her and her husband for they had not been able to save their four and a half month baby from infant death For the past few years, Mabel had always ... indicate rather extreme casualty for the purpose of the author to draw a picture of a real awkward salesman, more or less reveal the informality of the American as the guests For an American,...

Ngày tải lên: 07/11/2012, 15:01

49 785 1
Besides increasing the number of universities,rasing the education quality is also urgent problem

Besides increasing the number of universities,rasing the education quality is also urgent problem

... SUMMARIES 1.The Ministry of Education and Training and the Vietnam Education builed the campaign to help pupils in disadvantaged areas The campaign attracted teacher and students’ participation ... especially in flood-hit areas, the Ministry of Education and Training and the Vietnam Education Trade Union have called for all teacher s , educational workers , student in economically advantaged ... to facilitate management and training This academic year, priority will go to seniors to be assigned email addresses with the department’s domain name to get graduation updates and vocational...

Ngày tải lên: 19/07/2013, 16:34

21 427 0
AMINIMUM NUMBER OF PHYSICAL EDUCATION CREDITS SHOULD BE REQUIRED FOR GRADUATION OF COLLEGE

AMINIMUM NUMBER OF PHYSICAL EDUCATION CREDITS SHOULD BE REQUIRED FOR GRADUATION OF COLLEGE

... the basis of mutual interactive behavior among individuals By this definition we learn that a cooperatives situation requires at least one competitor to fail for each competitor that wins Thanks ... football, basketball…helps develop social skills, when participating in them, we can recognize the true meaning of cooperation which is defined as a situation in which rewards are distributed equally ... we can learn to share, to be self sacrificed,to work together with others for common goal These are the reasons why I feel physical courses should be part of the graduation requirements of any...

Ngày tải lên: 02/08/2013, 01:27

2 961 0
EFFECT OF THE NUMBER OF THE VERTICAL PIPES FOR THE PASSIVE AERATION ON THE COMPOSTING RATE

EFFECT OF THE NUMBER OF THE VERTICAL PIPES FOR THE PASSIVE AERATION ON THE COMPOSTING RATE

... 7-13 Nagasaki K., Akakura N and Atsumi K (199 8a) Degradation Patterns of Organic Material in Batch and Fed-batch composting operations, Waste Management & Research, 16 (5), 484-489 Nakasaki, K., ... K., Kuratomi, H., Wakizaka, H., Hiyama, R and Akakura, R (1998b) Quantitative Analysis of Ammonia and Odorous Sulfur Compounds Evolved During Thermophilic Composting, Waste Management & Research, ... mass Perforated pipes Fresh Air by the natural convection Fig Schematic diagram of the composting reactor Analytical methods The concentration of CO2 was measured using an online infrared analyzer...

Ngày tải lên: 05/09/2013, 08:40

8 622 1
Tài liệu 67 Detection: Determining the Number of Sources pptx

Tài liệu 67 Detection: Determining the Number of Sources pptx

... Information Most of the original papers on model order determination appeared in the statistical literature in journals such as The Annals of Statistics and the Journal of Multivariate Analysis ... number of sources and (2) isolating and analyzing the signal produced by each source We make this distinction because many of the algorithms for separating and processing array signals make the assumption ... that the eigenvalues of a complex correlation matrix are real and that the eigenvectors are complex and orthonormal, the number of degrees of freedom in the parameters of the model is classically...

Ngày tải lên: 16/12/2013, 04:15

11 430 0
Tài liệu Báo cáo khoa học: AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning ppt

Tài liệu Báo cáo khoa học: AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning ppt

... CGCGAATTCAGATTATGAAACAATAAG CGCGAATTCTTATGTCAGTACAAGTTTTTG CGCGAATTCCTTATGAAGAAGCTCCGTC CTTCAACAGACAAGTCC AGCAATACTAGTTTTATA CGCGAATTCGCTAGCGTCGCTCAAATTCAAAGTGCG AGGAGATCTGCGACTAACTCATCAGAGG GCATGAATTCATCGCGAACTGCTATTGGTTCCAG ... GCATGAATTCATCGCGAACTGCTATTGGTTCCAG GGTACTGCCGGGCCTCCTGCGG ACAACTGTTAAGGTTAAATCCGGAGATACCCTTTGGGCG TCAATTCATAAGGTCGTTAAAGGAGATACTCTCTGG AGCGGAATTCAATAATTTATTTTATTCGTAGATACTGACC EcoRI EcoRI EcoRI 2864 ... C The N-acetylglucosaminidase AcmA Fig (A) Expression of AcmA derivatives A1 , A2 , A3 and A4 in the L lactis NZ9000 mutants acmAD1 and acmAD1 DhtrA, visualized by zymographic analysis of culture...

Ngày tải lên: 19/02/2014, 18:20

15 460 0
Tài liệu Báo cáo khoa học: "Selecting the “Right” Number of Senses Based on Clustering Criterion Functions" pdf

Tài liệu Báo cáo khoa học: "Selecting the “Right” Number of Senses Based on Clustering Criterion Functions" pdf

... predicts senses (square) while in fact there are actual senses (triangle) It is significant that the graph of P K2 provides a clearer representation of the plateau than does that of H2 2.3 PK3 P K3 ... typically unambiguous) are replaced with a single name to create pseudo or false ambiguities For example, we replaced all mentions of Bill Clinton and Tony Blair with a single name that can refer ... the value of P K3 rising and falling dramatically in the critical region, suggesting a need for additional points to make it less localized P K3 is similar in spirit to (Salvador and Chan, 2004),...

Ngày tải lên: 22/02/2014, 02:20

4 361 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx

Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx

... Bhargava, The density of discriminants of quartic rings and fields, Ann of Math 162 (2005), 1031–1063 [3] ——— , The density of of discriminants of quintic rings and fields, Ann of Math., to appear ... elementary arguments from the geometry of numbers and linear algebra Acknowledgments The authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of ... can formulate similar ideas in the general case Let L be such a number field Then OL is a lattice endowed with a natural quadratic form, namely x → tr(x2 ); as such, it defines an element [L] of...

Ngày tải lên: 06/03/2014, 08:21

20 479 0
Đề tài " Growth of the number of simple closed geodesics on hyperbolic surfaces " docx

Đề tài " Growth of the number of simple closed geodesics on hyperbolic surfaces " docx

... surface X is a closed subset of X which is a disjoint union of simple geodesics A measured geodesic lamination is a geodesic lamination that carries a transverse invariant measure Namely, a compactly ... A Margulis, Applications of ergodic theory to the investigation of manifolds of negative curvature, Funct Anal Appl (1969), 335–336 [Mas1] H Masur, Interval exchange transformations and measured ... [FLP] A Fathi, F Laudenbach, and V Poenaru, Travaux de Thurston sur les Surfaces, Ast´risque 66–67, Soc Math France, Paris, 1979 e [Gol] W Goldman, The symplectic nature of fundamental groups of...

Ngày tải lên: 06/03/2014, 08:21

30 441 0
24,185 OUTLETS - The number of JApAN pOST BANk outlets in Japan docx

24,185 OUTLETS - The number of JApAN pOST BANk outlets in Japan docx

... network, which gives us a close-by presence for customers throughout Japan.  For this reason, the Bank is known in Japan as “the people’s savings bank” Customers also trust the Bank because of its high capital adequacy ratio  and stable management. These factors are a direct result of our policy of ... community place KAMIONGATA POST OFFICE ZENKOJI POST OFFICE JAPAN POST BANK Annual Report 2010 15 special Feature strength ConfidenCe a Massive amount of Deposits the Largest Balance of Deposits ... As mentioned previously, Japan has the largest amount of savings in the  world, and with its deposits of about ¥175 trillion, the Bank has a share of about 25% of Japan’s deposits. This is a dominant share that exceeds the ...

Ngày tải lên: 06/03/2014, 10:20

8 377 0
Cách sử dụng (Something) is down to (a number of something) pdf

Cách sử dụng (Something) is down to (a number of something) pdf

... to half a bag of rice” = “chúng n a bao gạo” Thông thường bạn nói số lượng vật/ đồ vật bị giảm, bạn liệt kê như: Now it’s down to just me, Claire, and Maria - Hiện tôi, Claire Maria Lưu ý sử ... thao “They’re down to teams now” = “giờ có đội” Hoặc nói việc bạn không sở hữu đồ vật mình: We sold the van, so we’re down to two vehicles now - bán xe tải, xe Hoặc đồ ăn: “We’re down to half a ... Với viết Daily English Speaking Lesson này, cho hiểu ro cách sử dụng " is down to " giao tiếp thường ngày Hãy xem thực hành cho ! “We’re down to only people now.” Công ty bạn v a gặp phải chút...

Ngày tải lên: 10/03/2014, 11:20

6 702 2
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc

... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... inflation expectations and inflation risk premia Due to a lack of data, we cannot this, and instead we estimate inflation forward rates as part of our model Vol No Estimating Inflation Expectations ... historical inflation Model-derived inflation expectations also have a number of advantages over expectations from market economists: unlike survey-based expectations, they are again available at any...

Ngày tải lên: 15/03/2014, 07:20

32 347 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... design of potential coadjuvants of those antimicrobial agents that are already available after incubation for 18–20 h at 37 °C Antibacterial activity was expressed as MIC, the concentration of peptide ... to allow one missed cleavage per peptide, a mass tolerance of 0.5 Da, and for carbamido-methylation of cysteines to be considered as a fixed modification and oxidation of methionines as a variable...

Ngày tải lên: 16/03/2014, 00:20

18 494 0
Cancer Research UK’s strategy 2009–2014: Cancer Research UK’s aim is to reduce the number of deaths from cancer. Our future plans are ambitious, but they are in line with the challenge and the responsibility we face. docx

Cancer Research UK’s strategy 2009–2014: Cancer Research UK’s aim is to reduce the number of deaths from cancer. Our future plans are ambitious, but they are in line with the challenge and the responsibility we face. docx

... reason why UK cancer survival rates are lower than in many other countries in Europe We aim to make earlier diagnosis of cancer a major focus and to act as a catalyst for action We are co-chairing ... treatment management All of these are aimed at reducing cancer incidence and increasing cancer survival Our strategy to reduce cancer mortality means there are other very important areas of cancer ... preventing cancer and is altered or inactivated in the vast majority of cases of the disease The ten year survival rate for cancer is now 42%, double the figure of 30 years ago Five year survival has...

Ngày tải lên: 22/03/2014, 16:21

32 396 0
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc

... this paper are those of the authors and are not necessarily those of the Reserve Bank of Australia Author: finlayr at domain rba.gov.au Media Of ce: rbainfo@rba.gov.au Abstract We estimate inflation ... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... inflation expectations and inflation risk premia Due to a lack of data we cannot this and instead estimate inflation forward rates as part of our model 18 inflation, a low 2-year break-even inflation...

Ngày tải lên: 22/03/2014, 20:20

39 395 0
Providing detailed guidelines for implementation of a number of articles of the law on enterprise

Providing detailed guidelines for implementation of a number of articles of the law on enterprise

... the case of a limited liability company; the chairman of the board of management and the director (general director) in the case of a shareholding company; all partners in the case of a partnership; ... managerial organization and operation of enterprises, except for the cases stipulated in clauses and of this article In a case where an international treaty of which the Socialist Republic of ... of the converted company in the case of a limited liability company; number of shares and value of shares already sold, and number of shares carrying the right to offer for sale in the case of...

Ngày tải lên: 27/03/2014, 10:15

28 630 0
Đề tài " The two possible values of the chromatic number of a random graph " pot

Đề tài " The two possible values of the chromatic number of a random graph " pot

... ) and apply Lemma below This lemma is a variant of the classical Laplace method of asymptotic analysis in the case of the Birkhoff polytope Bk , i.e., the set of all k × k doubly stochastic matrices ... Annals of Mathematics, 162 (2005), 1335–1351 The two possible values of the chromatic number of a random graph By Dimitris Achlioptas and Assaf Naor* Abstract Given d ∈ (0, ... consider all pairs of balanced partitions and, for each pair, bound the probability that both partitions are valid colorings For any fixed pair of partitions σ and τ , since edges are chosen independently,...

Ngày tải lên: 29/03/2014, 07:20

18 510 0
Xem thêm
w