a usss case study of large scale industrialized cybercrime
Understanding internal driven factors of household intention to upgrade waste treatment system a case study of small scale cow farming in le chi commune gia lam ha noi
... Understanding internal driven factors of household intention to upgrade waste treatment system: a case study of small -scale cow farming in Le Chi Commune, Gia Lam, Ha Noi Nguyen Thi Huong Giang* ... waste management at household level is one of the biggest challenges for environmental managers in Vietnam for several years Understanding internal factors, which driven waste management behavior ... Department of Environmental Management, Faculty of Environment, Vietna,m National University of Agriculture * Corresponding author: giangnguyenln@gmail.com, Mobile No.: (84)915243136 Abstract...
Ngày tải lên: 17/03/2021, 20:38
Changes in the Economic Value of Variable Generation at High Penetration Levels: A Pilot Case Study of California pot
... reliability-based approach to determine the amount of generation capacity that needs to be available in order to meet a reliability planning standard A common approach sets a target loss of load ... ERNEST ORLANDO LAWRENCE BERKELEY NATIONAL LABORATORY Changes in the Economic Value of Variable Generation at High Penetration Levels: A Pilot Case Study of California Andrew Mills and Ryan Wiser ... the energy value of a flat block of power (and similar to the fuel and variable O&M cost of natural gas CCGT Table ES.1: Decomposition of the marginal economic value of variable generation in 2030...
Ngày tải lên: 08/03/2014, 06:20
UNDERSTANDING INTERPROFESSIONAL EDUCATION: A MULTIPLE-CASE STUDY OF STUDENTS, FACULTY, AND ADMINISTRATORS
... essentials for baccalaureate... professionals that ultimately impair patient care and outcomes (Anderson, Thorpe, & Hammick, 2011; Ryan & McKenna, 1994) Although IPE can span all healthcare professions, ... Education (ACPE) and the American Association of Colleges of Nurses (AACN) specifically state guidelines and essentials for IPE (ACPE, 2011; AACN, 2008) One of the AACN’s nine essentials ... Collaborative Expert Panel, 2011) These competency domains serve as a catalyst for health professions and organizations to take action with IPE Today, accreditation and professional organizations...
Ngày tải lên: 24/08/2014, 09:34
On Teaching Economics 1: A Qualitative Case Study Of A South African University
... Olugbenga Adedeji, Mr Mark Sandham, Baba Bankole, Professor & Dr Jimoh Pedro, Alaagba Ayobami, Mr Victor Abiola & family, Mr Jabu Msithini and Mr Ayo Majekodunmi There is so much to say about these ... of the Witwatersrand, Johannesburg, South Africa ON TEACHING ECONOMICS 1: A QUALITATIVE CASE STUDY OF A SOUTH AFRICAN UNIVERSITY Emmanuel Oluseun OJO A thesis submitted to the Faculty of Humanities ... away from home to think, reflect and write I strained many times when Morianuoluwagba said, ‘Dad, are you going again? Are you coming back at night again?’ Those many nights when via video calls...
Ngày tải lên: 12/12/2016, 20:23
A BIOGEOGRAPHICAL CASE STUDY OF DIDERMA HEMISPHAERICUM (MYXOMYCOTA) predicting local habitat suitability in changing climate scenarios and assessing genetic diversity across southeast asian populations
... coordinates 52 LIST OF ABBREVIATIONS AMOVA Analysis of Molecular Variance BLAST Basic local alignment search tool COI Cytochrome c oxidase DNA Deoxyribonucleic Acid EF 1a Elongation factor alpha ... a very hot German summer – Frau Anja Klahr, Dr Manuela Bog, Oleg Shchepin, Jan Woyzichovski, Melanie Zacharias and Paul Lamkowski Huge thanks to my Lola Flor, Kuya Etang, Kuya Eric and Kuya ... THAI NGUYEN UNIVERSITY UNIVERSITY OF AGRICULTURE AND FORESTRY KING JOSHUA ALMADRONES REYES A BIOGEOGRAPHICAL CASE STUDY OF DIDERMA HEMISPHAERICUM (MYXOMYCOTA): PREDICTING LOCAL HABITAT SUITABILITY...
Ngày tải lên: 06/01/2020, 11:28
Teachers’ use of tiered lessons as a differentiated instruction strategy a multiple case study of three primary efl classrooms
... VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF ENGLISH LANGUAGE TEACHER EDUCATION GRADUATION PAPER TEACHERS’ USE OF TIERED LESSONS AS A DIFFERENTIATED ... suggested preparation and pedagogical implications from this study might encourage the administrators of the Faculty of English Language Teacher Education, University of Languages and International Studies ... bridge that gap, this qualitative case study aims to investigate teachers’ use of tiered lessons as a differentiated instruction strategy in three primary EFL classes Three research questions of this...
Ngày tải lên: 16/03/2021, 09:39
TRANSGENDER IDENTITY a MULTIPLE CASE STUDY OF FEMALE TO MALE TRANSGENDER PEOPLE = DANH TÍNH của NGƯỜI CHUYỂN GIỚI NGHIÊN cứu đa TRƯỜNG hợp về NGƯỜI CHUYỂN GIỚI từ nữ SANG NAM
... not aim to generalize the results A future study with a larger group of participants and/or a more quantitatively oriented approach may be able to generate a broader picture and patterns of identity ... reassignment, inadequate healthcare, and ignorance and discrimination as a result of heteronormativity and cisnormativity At a practical level, the study hopes to contribute a voice to advocate for more ... VIETNAM NATIONAL UNIVERSITY UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF LINGUISTICS AND CULTURES OF ENGLISH-SPEAKING COUNTRIES GRADUATION PAPER TRANSGENDER IDENTITY: A MULTIPLE CASE...
Ngày tải lên: 08/09/2021, 15:40
Soft prosody and embodied attunement in therapeutic interaction a multimethod case study of a moment of change
... psychotherapy, silence is often seen as a desirable element of the interaction, and one that can be a pathway to displays of affiliation and empathy (Hill, Thompson, & Ladany, 2003) According ... than in language, leading to a shared experience of affective attunement, and contributing to a change in meaning-making Soft prosody and silences are easily audible “cues”; they can facilitate ... Seikkula, J (2011) Becoming Dialogical: Psychotherapy or a Way of Life? The Australian and New Zealand Journal of Family therapy, 32, 179–193 Seikkula, J & Arnkil, T.E (2014) Open dialogues and anticipations:...
Ngày tải lên: 11/10/2022, 12:19
the impact of internet banking on banks a descriptive and evaluative case study of a large united states bank (lusb)
... THE IMPACT OF INTERNET BANKING ON BANKS: A DESCRIPTIVE AND EVALUATIVE CASE STUDY OF A LARGE U.S BANK (LUSB) by Tom Wamalwa A Dissertation Presented in Partial Fulfillment Of the Requirements ... 1346 Ann Arbor, MI 48106-1346 © Tom Wamalwa, 2006 All Rights Reserved Abstract Banks have adopted Internet Banking during the past ten years This descriptive and evaluative case study examined ... internal processes, and intangible assets of one large bank Online security and privacy were important to all banks and collecting of customer information was minimal The banks in the study operationalized...
Ngày tải lên: 03/06/2014, 02:15
Knowing the influences of context on electronic market adoption a case study of non acceptance of electronic market in large sized companies in china
... the features of the organization rather than the features of e-market technology This thesis indicates that one core institutional feature for an organization is that the organization is always ... (Avgerou, 2001; Avgerou et al., 2004; Walsham & Waema, 1994; Walsham & Sahay, 1999).Once it has adopted the e-market, the organization may face some new changes that make it hard for it to fit ... its adoption of the e-market This study indicates that the organization has to be situated in its contexts at all times As a result, an organization, which wants to gain the real benefits of using...
Ngày tải lên: 08/11/2015, 17:24
Potential of biochart production from agriculture resedues at household scale a case study of go cong tay district
... durum wheat European Journal of Agronomy 2011;34:231-8 Vongsaysana S, Achara U Comparison of the physical and chemical properties of briquette and wood charcoal in Khammouane province, Lao PDR ... Because of the large area of rice field as well as the high productivity, rice straw is a cheap and available material The experimental burner is simple and inexpensive The operation is easy ... 2016; Nipa et al., 2016; Jin et al., 2016) However, application of biochar as an alternative energy in Vietnam is lacking (Duong and Yoshiro, 2015) Electroniccopy copy available available at: Electronic...
Ngày tải lên: 28/01/2022, 13:58
FINANCIAL ASSISTANCE FUNDING OPPORTUNITY ANNOUNCEMENT - Small Business Innovation Research (SBIR) pdf
... NUMBER OF AWARDS DOE anticipates making approximately 162 awards under this FOA SBIR and STTR awards are subject to the availability of appropriated funds and this FOA does not obligate DOE to make ... funding of either basic or applied research at a DOE National Laboratory and is available for transfer to the private sector The level of technology maturity will vary and applicants are encouraged ... 17 can be found on the DOE Financial Assistance Forms and Information For Applicants and Recipients web page at http://energy.gov/management/office-management/operationalmanagement/financial-assistance/financial-assistance-forms,...
Ngày tải lên: 23/03/2014, 03:20
current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc
... FSoft has established FPT Software Japan, Ltd with its headquarters in Tokyo and a representative office in Osaka, Japan Following the success of FPT Software Japan, FPT Software APAC was established ... : Japanese levels of proficiency or experience LAN : Local Area Network NASDAQ : National Association of Securities Dealers Automated Quotation System NASSCOM : National Association of Software ... historical legacy that has created a greater awareness of French and English than many East Asian rivals Young Vietnamese with better English communication have already overcome the language barrier...
Ngày tải lên: 27/10/2012, 16:41
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... respectful attitudes of Paley and Alvarez towards the value of life are always appreciated, especially in the contemporary age of technology, diseases and social evils, which has caused escalating ... mother had done was apparently a revenge against her and her husband for they had not been able to save their four and a half month baby from infant death For the past few years, Mabel had always ... indicate rather extreme casualty for the purpose of the author to draw a picture of a real awkward salesman, more or less reveal the informality of the American as the guests For an American,...
Ngày tải lên: 07/11/2012, 15:01
Besides increasing the number of universities,rasing the education quality is also urgent problem
... SUMMARIES 1.The Ministry of Education and Training and the Vietnam Education builed the campaign to help pupils in disadvantaged areas The campaign attracted teacher and students’ participation ... especially in flood-hit areas, the Ministry of Education and Training and the Vietnam Education Trade Union have called for all teacher s , educational workers , student in economically advantaged ... to facilitate management and training This academic year, priority will go to seniors to be assigned email addresses with the department’s domain name to get graduation updates and vocational...
Ngày tải lên: 19/07/2013, 16:34
Tài liệu 67 Detection: Determining the Number of Sources pptx
... Information Most of the original papers on model order determination appeared in the statistical literature in journals such as The Annals of Statistics and the Journal of Multivariate Analysis ... number of sources and (2) isolating and analyzing the signal produced by each source We make this distinction because many of the algorithms for separating and processing array signals make the assumption ... that the eigenvalues of a complex correlation matrix are real and that the eigenvectors are complex and orthonormal, the number of degrees of freedom in the parameters of the model is classically...
Ngày tải lên: 16/12/2013, 04:15
Tài liệu Báo cáo khoa học: AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning ppt
... CGCGAATTCAGATTATGAAACAATAAG CGCGAATTCTTATGTCAGTACAAGTTTTTG CGCGAATTCCTTATGAAGAAGCTCCGTC CTTCAACAGACAAGTCC AGCAATACTAGTTTTATA CGCGAATTCGCTAGCGTCGCTCAAATTCAAAGTGCG AGGAGATCTGCGACTAACTCATCAGAGG GCATGAATTCATCGCGAACTGCTATTGGTTCCAG ... GCATGAATTCATCGCGAACTGCTATTGGTTCCAG GGTACTGCCGGGCCTCCTGCGG ACAACTGTTAAGGTTAAATCCGGAGATACCCTTTGGGCG TCAATTCATAAGGTCGTTAAAGGAGATACTCTCTGG AGCGGAATTCAATAATTTATTTTATTCGTAGATACTGACC EcoRI EcoRI EcoRI 2864 ... C The N-acetylglucosaminidase AcmA Fig (A) Expression of AcmA derivatives A1 , A2 , A3 and A4 in the L lactis NZ9000 mutants acmAD1 and acmAD1 DhtrA, visualized by zymographic analysis of culture...
Ngày tải lên: 19/02/2014, 18:20
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... Bhargava, The density of discriminants of quartic rings and fields, Ann of Math 162 (2005), 1031–1063 [3] ——— , The density of of discriminants of quintic rings and fields, Ann of Math., to appear ... elementary arguments from the geometry of numbers and linear algebra Acknowledgments The authors are grateful for the hospitality of the American Institute of Mathematics, where the first phase of ... can formulate similar ideas in the general case Let L be such a number field Then OL is a lattice endowed with a natural quadratic form, namely x → tr(x2 ); as such, it defines an element [L] of...
Ngày tải lên: 06/03/2014, 08:21
Đề tài " Growth of the number of simple closed geodesics on hyperbolic surfaces " docx
... surface X is a closed subset of X which is a disjoint union of simple geodesics A measured geodesic lamination is a geodesic lamination that carries a transverse invariant measure Namely, a compactly ... A Margulis, Applications of ergodic theory to the investigation of manifolds of negative curvature, Funct Anal Appl (1969), 335–336 [Mas1] H Masur, Interval exchange transformations and measured ... [FLP] A Fathi, F Laudenbach, and V Poenaru, Travaux de Thurston sur les Surfaces, Ast´risque 66–67, Soc Math France, Paris, 1979 e [Gol] W Goldman, The symplectic nature of fundamental groups of...
Ngày tải lên: 06/03/2014, 08:21
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc
... ) and H2(xt )) are used to calculate a set of forecast observation points This set of points is used to estimate a mean and variance of the data forecasts • The mean and variance of the data ... inflation expectations and inflation risk premia Due to a lack of data, we cannot this, and instead we estimate inflation forward rates as part of our model Vol No Estimating Inflation Expectations ... historical inflation Model-derived inflation expectations also have a number of advantages over expectations from market economists: unlike survey-based expectations, they are again available at any...
Ngày tải lên: 15/03/2014, 07:20