a universal approach to description of ionization of atoms

... predictors of response to LAM and ADV therapies are similar to those for IFN except that baseline HBV DNA may not be very important Individualization of HBV Treatment As summarized in Table and ... years, ALT has been used as a standard surrogate for the activity of CHB Thus, ALT level in combination with HBV DNA level and histological activity has been used as a determinant for HBV treatment ... important for planning and monitoring HBV treatment A low level of pre-treatment serum HBV DNA, high levels of ALT and histological activity, a history of adulthood HBV infection, and non-Asian...

Ngày tải lên: 03/11/2012, 09:41

... associated with Young tableaux in such a way are called tableau words Example 5.9 The tableau word associatied with the Young tableau a3 a5 a2 a2 T= a1 a1 a1 a4 is w(T ) = a3 a2 a1 a5 a2 a1 a1 ... Permutation, matrices and generalized Young tableaux, Pacific J Math., 34, 709–727, 1970 [13] D Krob, E .A Vassilieva, Performance analysis of demodulation with diversity – A combinatorial approach ... process to their mirror images are equal (cf [7, 15]) A word w(T ) can be associated with a Young tableau T over an alphabet A, by reading the columns of T from top to bottom and from left to right...

Ngày tải lên: 07/08/2014, 13:21

... central concern of applied linguistic As a matter of fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central ... time available/ in the available time.(1) We have to exploit all available potential/ all potential available in our country (2) As we know that when changing the position of adjective available...

Ngày tải lên: 10/04/2013, 14:46

... managers or staff to accept change is often rooted in a culture of inertia and bureaucratic thinking Failure or inability of an agency’s management or staff to adapt to changed conditions can also bring ... Defense, and Homeland Security; the Federal Aviation Administrations (FAA); the National Aeronautics and Space Administration (NASA); and the White House Office of Science and Technology to plan the ... attempting to impose a transformational change into their organizations (Slavin and Woodard 2006, 23): We close with a caution and a challenge Transformation has many elements, and the failure of any...

Ngày tải lên: 15/02/2014, 20:20

... orbital frontal cortex was greater for stimuli classified as beautiful, and the authors argued that this activation in the orbital frontal cortex was due to the reward value of beautiful paintings ... pictures, beautiful pictures activated a Wide A Biological Approach to a Model of Aesthetic Experience 438 439 Chapter Twenty One network of areas including the occipital, parietal, and frontal lobes ... network than before, again including the occipital, temporal, and the frontal lobes, but in particular bilateral orbital frontal corlex What the results of Kawabata and Zeki (2004) and Skov ef al (2005)...

Ngày tải lên: 19/02/2014, 17:20

... assessment of the sources of risk assurance available to the Board and the audit committee An evaluation of the level of assurance that has been obtained is also necessary Often, a major source of risk ... analysis Analysis of processes and operations within the organisation to identify critical components that are key to success G HAZOP and FMEA approaches Hazard and Operability studies and Failure ... types of risk, and some organisations have produced a risk appetite statement that is applicable to all classes of risk It is fairly easy for an organisation to confirm that it has no appetite...

Ngày tải lên: 21/02/2014, 12:20

... prepositio'~aT-~rase rather than as an adverbial phrase No attempt is made to show any paraphrase relationships Putative deleted or a 161 either close a previously opened adjective phrase and continue an already ... of the T-tag look up procedure against samples of the corpus that have been manually parsed accordiug to the rules contained in the Case Law Manual ~here alternative T-tags are assigned for any ... schematic diagram: WORD TAGGED CORPUS -~ T-TAG A~ IGNFLENT (PARTIAL PARSE) -~ BRACKET CLOSING AND T-TAG SELECTION - ~ CONSTITUENT ANALYSIS Phrasal ,nd clausal categories and boundaries are assigned...

Ngày tải lên: 22/02/2014, 09:20

... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards are indicated at the left and right of the agarose gels (B) Visualization and separation of high molecular mass...

Ngày tải lên: 07/03/2014, 09:20

... essential in bootstrapping to evaluate the quality of the patterns automatically IE and QA approaches, due to uniqueness assumptions of the real-world relations that these methods search for, have an ... Constructing semantic space models from parsed corpora In Proc of ACL Chris D Paice 1981 The automatic generation of literary abstracts: an approach based on the identification of self-indicating phrases ... they have two core concepts and a syntactic and semantic Human evaluation We next perform two human experiments to indirectly evaluate the quality of the automatically generated cue phrase variants...

Ngày tải lên: 08/03/2014, 02:21

... and a semantic role of a head word All definition sentences in RSK were analyzed by JUMAN, a Japanese morphological analyzer, and KNP, a Japanese syntactic and case analyzer (Kurohashi and Nagao, ... aspects of meaning construction in natural language The MIT Press Charles J Fillmore 1968 The case for case Holt, Rinehart and Winston, New York Satoru Ikehara, Masahiro Miyazaki, Satoshi Shirai, Akio ... parsing system In Proceedings of the First International Conference on Language Resources ~ Evaluation, pages 719724 Sadao Kurohashi, Masaki Murata, Yasunori Yata, Mitsunobu Shimada, and Makoto...

Ngày tải lên: 08/03/2014, 06:20

... early as ill-formed In Figure we give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra ... Council of Canada [1] Reduplication is a word formation process involving the repetition of a word or a part of a word As an example, in Warlpiri there is a process of nominal reduplication to form ... ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example illustrates a number of instances of phonological...

Ngày tải lên: 08/03/2014, 18:20

... health information to create an overall health index of use as an indicator of sustainable development IX APPROACHES TO SUSTAINABLE DEVELOPMENT INDICATORS This report spells out an approach to ... represents an attempt to reconcile or establish a balance among economic, social, and environmental factors As part of efforts to give the term operational meaning, many proposals for indicators of sustainable ... pressure and state indicators How existing economic and social indicators fit into such a framework also appears to be somewhat arbitrary A second approach, proposed by Peter Bartelmus of UNSTAT,...

Ngày tải lên: 15/03/2014, 16:20

... suitable external media for its storage and retrieval Of far greater concern is the fact that we are not fully aware of the mental processes involved in the performance of the translation task ... only As regards the second aim, the TCj which accompany a current word may reveal that it could be a possible indicator of a main clause, or subordinate clause, or a phrase If such is the case, an ... possible, starters of main clauses, (4) actual, or possible, starters of subordinate clauses, (5) actual, or possible, predicates for each clause, and (6) actual, or possible, phrase starters As a result...

Ngày tải lên: 16/03/2014, 19:20

... Monografia Yhdistelmäväitöskirja (yhteenveto + erillisartikkelit) Tiedekunta Kemian ja materiaalitieteiden tiedekunta Laitos Puunjalostustekniikan laitos Tutkimusala Puunjalostuksen kemia Vastaväittäjä(t) ... Tuula, Susanna, Katri, and Juha as an integral part of my intellectual welfare I have had the privilege to be able to attend several international conferences, to meet new colleagues, and to see some ... phenomena in paper, and to the properties of paper as a material In this thesis of basic research, an approach derived primarily from adsorption, adhesion, and polymer sciences was applied to study...

Ngày tải lên: 18/03/2014, 02:20

... computational study in the literature that can be applied to the automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and generator called HAHAcronym ... “palatable” neologisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing and have a nice ... annotators agreed on the annotation of this dimension Table shows the micro and macro-average of the percentage of cases in which at least annotators have labeled the ingredients as appropriate (APP),...

Ngày tải lên: 23/03/2014, 14:20

... basis of manner-class information alone and checks its conformance to the universal principles of grammar in GP as well as to languagespecific constraints In cases of conflict with either, a ... design and Windows application programming It uses standard object-class libraries for screen management, standard relational database tools for control of the lexicon and standard code for FFT as ... defining a quadratic discriminant based on the variance-covariance Figure Stagewise cue invocation strategy This launches the calculation of cues 4)5 (for the automatic segmentation process) and 4)6...

Ngày tải lên: 31/03/2014, 04:20

... conception of a fascist-type totalitarian state.” This possibility of a totalitarian state, of whatever type, is clearly repugnant to Turchin, and his personal experience is a witness that he is ... These are only the clearest examples A detailed analysis of animal behavior leads to the conclusion that the performance of any complex action requires that the animal resolve a large number of ... Fragmentation of a stabilized image Fragmentation does not occur chaotically and it is not independent of the type of image, as is the case when a drawing on a chalkboard is erased with a rag;...

Ngày tải lên: 08/04/2014, 12:58

... that moves from data collection and database creation, towards data management, and ultimately, data analysis and understanding For example, data processing is a base function enabling manipulation ... that presents un-interpreted bits of fact Han and Kamber (2001) suggest an evolution that moves from data collection and database creation, towards data management, and ultimately, data analysis ... Research design: Qualitative, quantitative, and mixed methods approaches (2nd ed.) Thousand Oaks, CA: Sage Publications Culnan, M J (1978) An analysis of the information usage patterns of academics...

Ngày tải lên: 02/06/2014, 09:38

... this use of sacrificial imagery ‘implies a replacement of ritual sacrifice and indicates an assumption that the death of Jesus had been a final sacrifice to end all sacrifices’ (Romans 16 (Dallas, Tex.: ... the story of the multiplication of the loaves and fishes with language that points ahead to the priestly action of Jesus at the Last Supper Mark writes of Jesus assuming a posture of prayer and ... Cape Town Dar es Salaam Hong Kong Karachi Kuala Lumpur Madrid Melbourne Mexico City Nairobi New Delhi Shanghai Taipei Toronto With of ces in Argentina Austria Brazil Chile Czech Republic France...

Ngày tải lên: 10/06/2014, 21:42

... Not part of the process Back translation(final language into source language) ≥ Professional, naïve translators NSE.# Professional translators NSE Professional, naïve translators NSE Translate ... 1: A comparison of cross-cultural adaptations of quality of life measures (Continued) Total number of formal translations At least forward and back translations At least forward translations and ... Backward Translation A qualified professional translator (affiliated with a commercial translating service in Canada) performed a single backward translation into the original language, for each of the...

Ngày tải lên: 18/06/2014, 19:20