a unified ontological geometrical and mechanical view of human anatomy

... obtain a reliable retrieval of the imaginary part of ℑµ for ±10% discordance of any of the other mechanical descriptors or of x1 On the other hand, it was shown that a ±10% discordance of the mechanical ... times of arrival and thus is fraught with ambiguity, especially when body wave and surface wave times of arrivals are close as at small offsets (Bodet 2005; Foti et al., 2009) or when many surface ... with errors of all sorts (noise, uncertainty of various physical and/ or geometrical parameters intervening in: the measurement or simulation of data, and the retrieval model of the displacement on...

Ngày tải lên: 18/03/2014, 01:21

... metabolism, and chorismate synthase and acetolactate synthase, which are necessary for amino acid biosynthesis Examples of species with a minimal set of enzymes are Pyrococcus abyssi, T maritima, and Saccharomyces ... this area has been the subject of numerous review articles that have attempted to fathom and rationalize the capabilities of the flavin cofactor [26–32] The complexity of flavincatalyzed reactions ... 2gqf), and a siderophore-interacting protein (family FAD_binding_9 in the clan FAD_Lum_binding) In addition, a novel covalent attachment between a side chain carboxylate group of an aspartate and...

Ngày tải lên: 28/03/2014, 22:20

... metabolism, and chorismate synthase and acetolactate synthase, which are necessary for amino acid biosynthesis Examples of species with a minimal set of enzymes are Pyrococcus abyssi, T maritima, and Saccharomyces ... this area has been the subject of numerous review articles that have attempted to fathom and rationalize the capabilities of the flavin cofactor [26–32] The complexity of flavincatalyzed reactions ... 2gqf), and a siderophore-interacting protein (family FAD_binding_9 in the clan FAD_Lum_binding) In addition, a novel covalent attachment between a side chain carboxylate group of an aspartate and...

Ngày tải lên: 28/03/2014, 22:21

... is attached (See additional files and 2: MAIL Scale Raw Scores and Mail Scale Variable Legend) The number of positive and negative responses to each of the inflammatory and mechanical signs and ... Inflammatory and Mechanical subscales was also performed Subject to normality being shown, the mean scores of each of the Inflammatory (Part A) and Mechanical (Part B) subscales of the MAIL Scale ... Chiropractic Clinic and 12 through private chiropractic practices in the Perth metropolitan area Mechanical and Inflammatory Low Back Pain Scale (MAIL Scale) The MAIL Scale scores for all participants...

Ngày tải lên: 13/08/2014, 15:21

... English and Vietnamese Thanks to both qualitative and quantiative approaches, the researcher can describe and analyze, then makes comparison and draws conclusions in order to reach the goals already ... subject And a positive declarative generally takes a negative tag-question whereas a negative declarative generally takes a positive tag-question, as follows: [7] I can’t be sure, can I? [8] And ... utterance of one Sp makes a certain response of the next Sp very likely The acts are ordered with first part and second part and categorized as question-answer, offer-acceptance and so on Each...

Ngày tải lên: 26/11/2013, 13:16

... in and more great By means of communication, people employ ways of thank-givings; the affect of Social and Cultural behaviors in language to exchange and express ideas and purposes, they are also ... syntactic and pragmatic features of thankgivings in English and Vietnamese The quantitative approach is also of syntactic and pragmatic features according to modern linguistic points of view ... conversation has become an indispensable demand of givings to reach for a successful conversation human Since language has consistently been the main element of 1.2 Aims and Objectives human social...

Ngày tải lên: 26/11/2013, 13:16

... FEATURES OF EWGH AND VWGT AS A data exactly, effectively and reliably SINGLE WORD 3.2 DESCRIPTION OF POPULATION AND SAMPLES 3.3 DATA COLLECTION 4.1.1 Syntactic Features of EWGH and VWGT as a ... syntactic and semantic CHAPTER features of EWGH and VWGT The quantitative and qualitative FINDINGS AND DISCUSSION analysis of the data are the supporting methods to help to analyze the 4.1 SYNTACTIC ... conclusion and implications have a better understanding of syntactic and semantic features of these WG so as to use correctly and effectively in teaching and learning, in communication and in reality...

Ngày tải lên: 26/11/2013, 13:16

... in English and Vietnamese fact that each language has its own grammatical rules and each unit 1.4 SCOPE OF THE STUDY of grammar has its own semantic and syntactic features So, the aim This study ... To analyze and recognize the values of semantic, and syntactic features of words and - To find out the similarities and differences of semantic, and So, the language of economics consisting of ... Similarities in Syntactic Features of Words and Phrases in Quotation Marks in English and Vietnamese Magazines Table 4.2 Summary of Vietnamese Words and Phrases in Quotation Marks in Syntactic Pattern...

Ngày tải lên: 26/11/2013, 13:18

... TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC ... reverse A B Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ... to Ala was carried out using the QuickChange kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT...

Ngày tải lên: 19/02/2014, 02:20

... Nakamura, K Katayama, and T Amano Journal of Applied Polymer Science 17:1031–1041, 1973 28 Quantification of Non-Isothermal, Multi-Phase Crystallization [23] V La Carrubba, V Brucato, and S Piccarolo ... of the rate and draw ratio dependence and is capable of quantitatively predicting the rate, angle and draw ratio dependence of the yield stress as well as time-to-failure in various off-axis tensile ... Kerkhof, S van Herwaarden, F van Herwaarden, and A Leenaers Thermochimica Acta 522((1-2)):36–45, 2011 [40] S van Herwaarden, E Iervolino, F van Herwaarden, T Wijffels, A Leenaers, and V Mathot...

Ngày tải lên: 22/02/2014, 09:20

... of the panels and compare the age effect on the physical and mechanical properties of the fiberboard 1.3 References Abd.Latif, M., W .A W Tarmeze, and A Fauzidah 1990 Anatomical features and mechanical ... physical, chemical, and mechanical properties, and consequently its processing and utilization The physical and mechanical properties of bamboo vary with the age of the bamboo and the height of ... chemical compositions of bamboo are correlated with its physical and mechanical properties Such variation can lead to obvious physical and mechanical properties changes during the growth and maturation...

Ngày tải lên: 22/02/2014, 09:20

... Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges ... the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary effects...

Ngày tải lên: 06/03/2014, 15:21

... implicated as the mediator of constitutional t(11;22) translocation in humans [38] Although there are also a large number of (CA)n and (GA)n repeats in the human genome, the frequency of their ... CA-repeat and CA-rich elements: a new class of regulators of mammalian alternative splicing EMBO J 24, 1988–1998 41 Waldman AS, Tran H, Goldsmith EC & Resnick MA (1999) Long inverted repeats are an ... light of the Gene Ontology (GO) profile of human orthologs Results Characters and distribution of LIRs in human autosomes We identified 2551 LIRs in human autosomes and approximately 87% of them have...

Ngày tải lên: 07/03/2014, 00:20

... the third parameters are trigrams of T and B respectively The second and the fourth are lexical generation probabilities Probabilities (1) and (2) can be calculated from POS tagged data with following ... identifiers assigned to POS tags We used the approach of Katz (Katz.1987) for parameter smoothing, and build a trigram model to predict the probabilities of parameter (1) and (3) In the case that unknown ... Street Journal distributed with the Penn Treebank II, and the definition of baseNP is the same as Ramshaw’s, Table summarizes the average performance on both baseNP tagging and POS tagging, each section...

Ngày tải lên: 08/03/2014, 05:20

... lateral and vertical stretching in histology (Rajadhyaksha et al., 1999b) Confocal images of the granular, spinous and basal cell layers correlated well with histology (Rajadhyaksha et al., 1999b) ... depth of the focal plane and combining the obtained images computationally, leads to a 3D image (Sheppard and Shotton, 1997; Rajadhyaksha and Zavislan, 1997) photomultiplier confocal aperture point ... scale enables examination of the mechanical behaviour of the top layers of the skin, whereas experiments at large length scale can be used to examine the mechanical behaviour of the deeper layers...

Ngày tải lên: 09/03/2014, 00:20

Ngày tải lên: 17/03/2014, 03:20

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... extracellular signal-regulated kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of ... displayed an apparent arrest of DNA and vacuolar segregation between the mother and daughter (Fig 6D; middle image) By 24 h, over half had adopted the terminal phenotype of enlarged, misshapen...

Ngày tải lên: 23/03/2014, 07:20

... comparable corpora (CS, CT) in languages S and T and produces a collection AS,T of similar article pairs (DS, DT) Each article pair (DS, DT) in AS,T consists of an article (DS) in language S and ... consisting of EK-L and ET-L Corpora in group S are relatively small in size, and contain pairs of articles that have been judged by human annotators as similar Corpora in group L are two orders of magnitude ... language families (Hindi from the Indo-Aryan family, Russian from the Slavic family, Kannada and Tamil from the Dravidian family) Note that none of the five languages use a common script and hence...

Ngày tải lên: 24/03/2014, 03:20

... (A Rekas, unpublished data on a- synuclein and j-casein) From the Arrhenius law, we have: ln(kapp) ¼ – EA ⁄ RT + ln (A) The activation energy of fibril formation (EA) was calculated (Table 1) as ... significantly decreased formation of this large aggregate As a result of the interaction of a- crystallin with reduced j-casein, a complex of similar mass (1500 kDa) to the one with native j-casein was ... which was particularly pronounced in the case of the native j-casein and a- crystallin mixture, where significant conformational flexibility was indicated by the appearance of additional cross-peaks...

Ngày tải lên: 30/03/2014, 04:20

... assembly of continuous bres, natural or manufactured x Nomenclature Roman letters mm/s2 a Acceleration A Area a Position of force application A. F Area of bre mm2 A. Y Area of yarn mm2 Af Area fraction ... Exchange Specication and denes a neutral data format that allows the digital exchange of information among CAD systems STEP stands for Standard for the Exchange of Product model data and was intended ... MODELLING OF TEXTILES And hence the bre area fraction A f can be expressed as: Af = A. Y. (2.69) Note that the yarn cross-sectional area A. Y may vary along the length of a yarn Appendix A contains a...

Ngày tải lên: 31/03/2014, 23:20