a unified evolutionary theory of human society

temple univ pr food and evolution toward a theory of human food habits jan 1987

temple univ pr food and evolution toward a theory of human food habits jan 1987

... Bangladesh (Lindenbaum), Amazonia (Johnson and Baksh, Good, Ross), Paraguay (Hawkes), Canadian sub-arctic (Winterhalder), Southeast Asia and Africa (Franke), Mexico (Pelto), Costa Rica (Edelman), ... influence has worked in a diversity of ways, as the Achuara case suggests The Achuara today tend to regard such animals as tapir, deer, 14 Overview of Trends in Dietary Variation and capybara as inedible ... practical of human affairs, there lies an ineluctable core of arbitrary, fortuitous, or irrational thought The seemingly inexhaustible variety and range of human dietary patterns thus has been taken...

Ngày tải lên: 11/06/2014, 16:29

645 298 0
Tài liệu tham khảo a theory of human motivation

Tài liệu tham khảo a theory of human motivation

... simply as a sick man This is a fair parallel to our designation as 'sick' of the man who lacks vitamins or minerals Who is to say that a lack of love is less important than a lack of vitamins? Since ... basic human needs are organized into a hierarchy of relative prepotency One main implication of this phrasing is that gratification becomes as important a concept as deprivation in motivation theory, ... who retains his childish attitudes toward the world That is to say, a neurotic adult may be said to behave 'as if' he were actually afraid of a spanking, or of his mother's disapproval, or of being...

Ngày tải lên: 07/07/2014, 10:38

25 435 0
Tài liệu Báo cáo khoa học: "A Finite-State Model of Human Sentence Processing" docx

Tài liệu Báo cáo khoa học: "A Finite-State Model of Human Sentence Processing" docx

... size of parameters until additional parameters are demanded by data Equally important, the quality of architectural simplicity should be maintained Among the different sources of information manipulated ... Journal of Memory and Language,, 47:50–68, 2002 C.D Manning and H Sch¨ tze Foundations of u Statistical Natural Language Processing The MIT Press, Cambridge, Massachusetts, 1999 S Narayanan and ... A total of 30 pairs of a garden-path sentence and its ambiguous, non-garden-path control were tested for a comparison of the probability decrease at the disambiguating region In 80% of the cases,...

Ngày tải lên: 20/02/2014, 11:21

8 446 0
HISTORY OF HUMAN SOCIETY pot

HISTORY OF HUMAN SOCIETY pot

... III SEATS OF EARLY CIVILIZATION VII LANGUAGE AND ART AS A MEANS OF CULTURE AND SOCIAL DEVELOPMENT 121 The origin of language has been a subject of controversy Language is an important social function ... culture Art as a language of aesthetic ideas Music is a form of language The dance as a means of dramatic expression The fine arts follow the development of language The love of the beautiful ... the humanists? Relation of humanism to language and literature Art and architecture The effect of humanism on social manners Relation of humanism to science and philosophy The study of the classics...

Ngày tải lên: 22/03/2014, 23:20

475 266 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... extracellular signal-regulated kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of ... isoforms of human cytosolic Hsp90 can therefore activate human ERK5 MAP kinase in yeast Rlm1p, the major trans-activator of cell wall genes in yeast, is activated through Slt2p-catalyzed phosphorylation...

Ngày tải lên: 23/03/2014, 07:20

11 427 0
Hints towards the formation of a more comprehensive theory of life. pptx

Hints towards the formation of a more comprehensive theory of life. pptx

... science of metals, and that of fossils (both as geologically applied); of crystallization; and of vegetable and animal physiology, in all its distinct branches The nature of the present essay scarcely ... certain of the latter, and unappropriating them to a yet unnamed triplicity; or that, being thus assisted, we may obtain a qualitative instead of a quantitative insight into vegetable animation, ... diversity of shape, and almost all of the same natural family These we may pass by as exceptions But the insect world, taken at large, appears as an intenser life, that has struggled itself loose and...

Ngày tải lên: 30/03/2014, 01:20

40 448 0
mendonc,a j.t. theory of photon acceleration

mendonc,a j.t. theory of photon acceleration

... beyond any reasonable doubt, the existence of photon acceleration and to provide an accurate quantitative test of the theory Actually, the spectral changes of laser beams by ionization of a neutral ... laws are derived and the ray-tracing equations are stated in their Hamiltonian, Lagrangian and covariant forms Chapter deals with the basic properties of photon dynamics, illustrated with examples ... incidence, as a particular case of photon acceleration at the moving boundary Actually, these formulae stay valid even for partial reflection at the boundary, for angles of incidence smaller than the...

Ngày tải lên: 24/04/2014, 17:21

232 821 0
functional discourse grammar a typologically-based theory of language structure sep 2008

functional discourse grammar a typologically-based theory of language structure sep 2008

... person attr attributive third person aug augmentative a actor aux auxiliary abil ability av actor voice abl ablative avol avolitional abs absolutive ben benefactive acc accusative caus causative acq ... bananas ’ “ then Jafa carried the basket and went upwards Went upwards he picked the bananas ” In many Indo-Pacific languages there are several grammatical phenomena that are a faithful and ... the idea of a Functional Discourse Grammar At the time it was conceived of as a revised version of Functional Grammar (FG; Dik 199 7a, 1997b), a theory of the organization of natural languages developed...

Ngày tải lên: 11/06/2014, 05:35

528 624 0
the evolutionary biology of human female sexuality sep 2008

the evolutionary biology of human female sexuality sep 2008

... Phylogenetic research of nonhuman primates similarly cannot establish that a homologous trait actually found in humans and shown to be an adaptation in nonhuman primates is also an adaptation in humans, ... Evolutionary Biology of Human Female Sexuality That all mammals have mammary glands demonstrates that there was evolutionary maintenance of the glands during the evolutionary history of mammals ... primordial mammary gland appeared As all extant species within all three of the major mammalian taxa (monotremes, marsupials, and placental mammals) possess mammary glands, this primordial gland almost...

Ngày tải lên: 11/06/2014, 10:37

422 234 0
báo cáo khoa học: "Therapeutic activity of two xanthones in a xenograft murine model of human chronic lymphocytic leukemia" doc

báo cáo khoa học: "Therapeutic activity of two xanthones in a xenograft murine model of human chronic lymphocytic leukemia" doc

... that allanxanthone C and macluraxanthone purified from Guttiferaes are capable of in vivo antileukemic effects in a xenograft murine model of human CLL These therapeutic activities of the natural ... treated with daily iv injections (0.2 ml in saline) on days to (arrows) of mg/kg of allanxanthone C (black triangle) or macluraxanthone in DMSO (white square) or of solvent (DMSO in saline) alone ... cells are also considered in order to define therapeutic targets Acknowledgements We are grateful to Drs A. G.B Azebaze (University of Douala, Cameroun) and A. E Nkengfack (University of Youndé, Cameroun)...

Ngày tải lên: 10/08/2014, 22:21

3 309 0
Báo cáo y học: "Unequal evolutionary conservation of human protein interactions in interologous networks" pdf

Báo cáo y học: "Unequal evolutionary conservation of human protein interactions in interologous networks" pdf

... inadequate sample sizes or sample bias in the early yeast PPI data Our human PPI dataset avoids some of the sample bias that has plagued the earlier yeast data, and is analogous to the 'HC' dataset ... Additional data files The following additional data are available with the online version of this paper Additional data file contains a list of all the PPI datasets that were compiled and used ... Zhong J, Mathivanan S, Karthick L, Chandrika KN, Mohan SS, Sharma S, Pinkert S, Nagaraju S, Periaswamy B, et al.: Analysis of the human protein interactome and comparison with yeast, worm and fly...

Ngày tải lên: 14/08/2014, 07:21

11 220 0
a study on theory of iceberg in  the old man and the sea  by earnest hemingway = nghiên cứu về nguyên lý tảng băng trôi trong tác phẩm  ông già và biển cả  của ernerst hemingway

a study on theory of iceberg in the old man and the sea by earnest hemingway = nghiên cứu về nguyên lý tảng băng trôi trong tác phẩm ông già và biển cả của ernerst hemingway

... in a small village on the northern coast of Cuba, below the Tropic of Cancer and not far from the capital city of Havana Havana is the capital of Cuba and forms a distant background to Santiago‘s ... and Halliday and Hasan, 1973, 1978, 1989, 1994) had drawn certain attention to this branch by clarifying some “contextual, grammar and cohesional models as well as pragmatic and conversational ... marlin's spear, Manolin demonstrates once and for all that he clearly understands and accepts all that Santiago wishes to bequeath him — and all that comes with that inheritance Another part of...

Ngày tải lên: 02/03/2015, 14:25

49 1,8K 7
LUẬN VĂN TỐT NGHIỆP A SYSTEM BASED THEORY OF ORGANIZZTIONAL INFORMATION

LUẬN VĂN TỐT NGHIỆP A SYSTEM BASED THEORY OF ORGANIZZTIONAL INFORMATION

... afford to explain simultaneously both the nature of organizational information and the process of organizational information creation in the same model We are unaware of any literature that approaches ... conceptualization of organizational information could make a firmly theoretical foundation for some theories of organization Practically, the examination could explain various phenomena of organization ... theory of organizational information It is a pragmatic theory of information in organizations, which is conceptualized as a system Our conceptualization of organizational information as system...

Ngày tải lên: 02/04/2015, 21:51

400 390 0
A systems based theory of oganizational information

A systems based theory of oganizational information

... dialectical evolution of organizational information: one, as organizational habit, it enables us to guide organizational activities; two, it indirectly enables organizational changes that are ... Case: Lean production solutions Total: organizations Total: organizational cases and embedded units of analysis Table 4.18 The distinction among three basic patterns of organizational information ... information could manifest itself as an association between data and knowledge, or a communal justification for a social mediation between a natural one (which embodies data) and humanistic one (which...

Ngày tải lên: 10/08/2015, 11:58

24 218 0
The raman effect a unified treatment of the theory of raman scattering by molecules   derek a  long

The raman effect a unified treatment of the theory of raman scattering by molecules derek a long

... 564 A2 1 Polarization of Electromagnetic Radiation A2 1.1 Introduction A2 1.2 States of Polarization: Monochromatic Radiation A2 1.2.1 Linear polarization A2 1.2.2 Elliptical and circular polarization ... polarization A2 1.2.3 Stokes parameters A2 1.2.4 Stokes parameters for scattered radiation A2 1.3 States of Polarization: Quasi-Monochromatic Radiation A2 1.4 Change of Polarization: Depolarization Ratios, ... rotational constant, vibrational dependence of 197–198 rotational degeneracy 172–173, 214 rotational invariants, isotropic averages and 487–498 rotational matrix, diagonalization of 406 rotational matrix...

Ngày tải lên: 17/03/2014, 14:46

611 443 0
a theory of political obligation membership commitment and the bonds of society jul 2006

a theory of political obligation membership commitment and the bonds of society jul 2006

... reason to A, and that all else is equal, and yet does not A 30 a problem of political obligation Again, to say that to have an obligation is to have sufficient reason to act in a certain way leaves ... Desiderata for a theory of political obligation 3.2 Some less than promising notions of membership Actual Contract Theory: Attractions 4.1 Actual contract theory 4.2 Analytic attractions 4.3 Moral attractions ... is not to say that if you have reason to act in a certain way you have an obligation to act in this way One may have reason to act in a certain way without having an obligation so to act, but not...

Ngày tải lên: 11/06/2014, 01:32

343 431 0
A Theory Of The Human-Capital Based Enterprisethe Firm In The Knowledge Economy

A Theory Of The Human-Capital Based Enterprisethe Firm In The Knowledge Economy

... human capital based firm depends on the “types” of human capital in the firm Having a homogeneous group of human capital involved in a firm may well lead to a different organisational form than that ... statistical organisations are naturally drawn to the workhorse of the ‘System of National Accounts’ as a source of such data Introduced during World War II as a measure of wartime production capacity, ... The assets of the corporation are protected from claims by investors Hansmann, and Kraakman (200 0a, b) and Hansmann, Kraakman and Squire (2005) emphasise the importance of this “asset separation”...

Ngày tải lên: 11/12/2016, 20:37

321 393 0
Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory

Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory

... Terzaghi theory CBC MAD -T1 AGC - AGC - 0.01 Data for Chicago Blue Clay (CBC) (Taylor 1948) and Azraq Green Clay (Al-Zoubi 1993) (AGC- & 8) and Madaba Clay (MAD - T1) cv / H m (Proposed) , / (a) ... Lambe and Whitman, 1969; Hossain, 1995; Sridharan and Prakash, 1995; Robinson, 1999) Based on the above (for an example, see Table 3), the similarity in the c v values of the proposed and Casagrande ... secondary compression range as demonstrated in Fig 2, because δ p is only a function of a and b that can be obtained from the primary consolidation range This extrapolation requires at least two data...

Ngày tải lên: 21/03/2013, 14:09

9 402 0
A contrastive analysis of metaphors relating to parts of human body in english and vietnamese

A contrastive analysis of metaphors relating to parts of human body in english and vietnamese

... # s # 96: :A 97AA7< " # ) z 97AAA< , ##5 ) 51mmm6 &+ - 97AA6< , • B 96:;:< , # / 96::?< " s ) • =3 & 96:::< ? "0B - D 2 96::F< C L * D 97AA8< , * ) s D 97AAA< " =L ) 96:::< ... () 97AA>, ::< "0B ! ' % ( ( ' G * 5 ( ' 9) 7AA>, 687< " ! / - , , , , HI HI HI HI J J J J HI HI HI HI J J J J HI HI HI HI J J J J HI HI HI ! ! J J J < & K K I I I ! I I $ $ / ( ! # B 97AA8, 88< ... 6::>< ( ' ( # ' < / 97AAA,8< (" + + ' $ $ < $ % & ( ' + < " $ / # & ( ' E / ( ' ( ' ! + ( + D # 96::>,?8< * ! % ) % & D / ( - ' ) ! : % / & - $ " $ / (( , ) 97AA>, 6A: < ! # + ; & ( ' < % %...

Ngày tải lên: 29/01/2014, 00:23

44 1,2K 7
w