a tilt in global intellectual property rules towards developed countries

INCENTIVES FOR GLOBAL PUBLIC HEALTH potx

INCENTIVES FOR GLOBAL PUBLIC HEALTH potx

... states, including Bolivia, Brazil, Chile, Columbia, Costa Rica, Nicaragua, Paraguay and Cuba; as well as China, India, Malaysia, the Philippines, Qatar, Uzbekistan and Japan; Morocco; the United States ... Bilateralism in Intellectual Property (2001) Journal of World Intellectual Property 791–808; Michael Westerhaus and Arachu Castro, ‘How Do Intellectual Property Law and International Trade Agreements ... Organization, the World Health Organization and the World Intellectual Property Organization Drawing upon international trade law, innovation policy, intellectual property law, health law, human...

Ngày tải lên: 07/03/2014, 10:20

536 5,7K 0
A study on students' motivation in reading skills at Quang Lower secondary school = Nghiên cứu về động lực học kỹ năng đọc hiểu của học sinh trường THCS Quảng Đ

A study on students' motivation in reading skills at Quang Lower secondary school = Nghiên cứu về động lực học kỹ năng đọc hiểu của học sinh trường THCS Quảng Đ

... can act as barriers or bridges to reading a new language and are the essential environmental ingredient for language reading The author also states that learning can only happen if certain affective ... reading materials The reading materials (or printed information) also play a very important role in reading learning environment Reading provides with access to information and today’s world information ... (1995) Language, Social Meaning, and Social Change: The Challenge for Teachers Paper presented at the 22nd annual JALT international conference on language teaching/learning, Nagoya, Japan Stipek,...

Ngày tải lên: 28/03/2015, 09:14

54 1,1K 2
báo cáo khoa học:" Quality of life at the dead sea region: the lower the better? an observational study" pptx

báo cáo khoa học:" Quality of life at the dead sea region: the lower the better? an observational study" pptx

... epidermal and immunologic activation J Am Acad Dermatol 2003, 49:451-457 Harari M, Shani J, Seidl V, Hristakieva E: Climatotherapy of atopic dermatitis at the Dead Sea: demographic evaluation and ... Torrance N, Smith BH, Lee AJ, Aucott L, Cardy A, Bennett MI: Analysing the SF-36 in population-based research A comparison of methods of statistical approaches using chronic pain as an example ... completed a structured self-administered questionnaire that was distributed at primary care clinics and via the kibbutz internal mail system Participation was on a voluntary basis The questionnaire had...

Ngày tải lên: 12/08/2014, 01:22

7 400 0
An investigation into learning and teaching english vocabulary at cua lo hihg school and some suggested activities to help students learn better

An investigation into learning and teaching english vocabulary at cua lo hihg school and some suggested activities to help students learn better

... teachers towards teaching English vocabulary - Their attitudes towards using games in teaching and learning vocabulary teaching and learning vocabulary - How they control the time of teaching ... vocabulary learning activities are given to be applied in teaching and learning this part with the aim to motivate students into learning vocabulary The last part is Conclusion This part summarizes ... new wants when the human society develops In other words, vocabulary is a mean of transferring the information, opinion and feelings Vocabulary plays an important role in language learning Because...

Ngày tải lên: 18/12/2013, 10:08

60 996 2
Tài liệu You Paid How Much For That - How To Win At Money Without Losing At Love (Wiley-2002) (pdf) pptx

Tài liệu You Paid How Much For That - How To Win At Money Without Losing At Love (Wiley-2002) (pdf) pptx

... was our turn Shawn and I were paddling along, and the water started moving faster Then all of a sudden, “Oh, my GOSH!!! We are headed straight towards a waterfall!!” I started desperately doing ... Natalie’s background in business and consumer science, and Scott and Howard’s backgrounds in both marital social science and business, we believe we are putting into your hands a book that can ... Specifically, we would like to thank Karl and Amy Locke, insurance professionals at Locke and Associates; David Cordova, CPA; and Mike Gegen, first vice president at Dain Rauscher, Inc., for sharing...

Ngày tải lên: 21/12/2013, 02:15

411 393 1
Methods of Policy Accommodation at the Interest-Rate Lower Bound  ppt

Methods of Policy Accommodation at the Interest-Rate Lower Bound  ppt

... demand for real balances); or an increase in the price level (so that the real monetary base does not increase by as large a proportion as the nominal increase) These familiar mechanisms may have ... Once nominal GDP again reaches the level of this path, it will be appropriate to raise nominal interest rates, to the level necessary to maintain a steady growth rate of nominal GDP thereafter ... usual in 2004 as anticipation of rate increases (of an unknown timing and speed) grew; and became significantly less sensitive than usual again in 2005 and early 2006, when the FOMC steadily increased...

Ngày tải lên: 15/03/2014, 14:20

97 494 0
THE PRICES IN THIS CATALOG CAN ONLY GET LOWER UNTIL JUNE 2013, NEVER HIGHER pot

THE PRICES IN THIS CATALOG CAN ONLY GET LOWER UNTIL JUNE 2013, NEVER HIGHER pot

... purchased) Read more about our Assembly Service on p 318 A thick velvet curtain can create a soft wall and in an instant one room turns into two 1 SANELA pair of curtains $49.99 Includes two curtain ... frame $279 If you read and surf the web in bed, the angled headboard is comfortable to lean against Slatted bed base and mattress are sold separately Painted finish Designer: Ola Wihlborg RA ... well-being An easy, fast and affordable way to showcase your creativity and give a home warmth and comfort Life ÅDUM rug, high pile See p 54 199 $ AINA pair of curtains $49.99 Includes two curtain panels...

Ngày tải lên: 17/03/2014, 00:20

165 213 0
Consultation on Improving Access to Health Worker at the Frontline for Better Maternal and Child Survival pptx

Consultation on Improving Access to Health Worker at the Frontline for Better Maternal and Child Survival pptx

... for Global Health and Social Transformation, Kampala Uganda Protestant Medical Bureau, Kampala Makerere University College of Health Sciences, Kampala UNAIDS, Kampala Ministry of Health, Kampala ... Kate Badoe Sagoe Ms Rose Kumwenda N'goma Country Organisation DRC Ethiopia Ministry of Health, Kinshasa UNAIDS, Addis Ababa Federal Ministry of Health, Addis Ababa, Ghana National Catholic Health ... Zimbabwe, Harare Ministry of Health and Child Welfare, Harare Zimbabwe Health Services Board, Harare AMREF, AMREF International Training Center, Langata Road, Nairobi Kenya EQUINET/Kenya Health Equity...

Ngày tải lên: 23/03/2014, 06:20

48 398 0
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx

Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx

... starting at nucleotide )622 (5¢-CCAAGACATACTAAGAATGG-3¢) and the same reverse primer ending at nucleotide +74 (5¢-GGCA GAGAAAACTCGAGAAC-3¢) as described above The 696 bp long PCR amplified fragment ... nucleotides )132 and +74 (forward: 5¢-GAATGTGGGTCTCAGAGTTCC-3¢ and reverse: 5¢-GGCAGAGAAAACTCGAGAAC-3¢) were designed to generate a 206 bp 5¢ flanking DNA fragment For DHPLC analysis, PCR was performed ... determined by capture ELISA Total liver protein was estimated by Bio-Rad protein assay kit where BSA was used as standard (A) Northern autoradiograph displaying levels of b2GPI mRNA in each lane (B)...

Ngày tải lên: 31/03/2014, 07:20

9 462 0
Báo cáo sinh học: "Research downsizing, mergers and increased outsourcing have reduced the depth of in-house translational medicine expertise and institutional memory at many pharmaceutical and biotech co" pdf

Báo cáo sinh học: "Research downsizing, mergers and increased outsourcing have reduced the depth of in-house translational medicine expertise and institutional memory at many pharmaceutical and biotech co" pdf

... human translational research This database could be maintained by a consortium of drug companies that voluntarily submit data and it would include human biomarker data, translatable human pharmacology ... human translational medicine database existed today and could be searched by drug target, pathway, biomarker, disease, therapeutic area, challenge agent and translational pharmacology model name ... development, principles of biomarker qualification and utilization in drug discovery and development, indepth examples of translational research in six different therapeutic areas, translational imaging...

Ngày tải lên: 18/06/2014, 19:20

3 266 0
báo cáo hóa học: " Too much or too little step width variability is associated with a fall history in older persons who walk at or near normal gait speed" pdf

báo cáo hóa học: " Too much or too little step width variability is associated with a fall history in older persons who walk at or near normal gait speed" pdf

... gait data collection, analyzed the data, and drafted the manuscript JEB participated in the data analyses and manuscript preparation JVS participated in the design of the study, data analyses, and ... activities, such as walking on ice that may affect balance.)" Participants, who reported a fall, were then asked to report the number of falls in the past year Data Analysis Prior to data analyses ... GaitMat II™ and analyzes the data In addition to the 4-meter long walkway, there are initial and final one meter inactive sections to allow for acceleration and deceleration of the participant...

Ngày tải lên: 19/06/2014, 10:20

8 403 0
Best Care at Lower Cost pot

Best Care at Lower Cost pot

... Continuously Learning Health Care in America Abstract Health care in America presents a fundamental paradox The past 50 years have seen an explosion in biomedical knowledge, dramatic innovation in ... Health Care in America Summary Health care in America presents a fundamental paradox The past 50 years have seen an explosion in biomedical knowledge, dramatic innovation in therapies and surgical ... Care at Lower Cost: The Path to Continuously Learning Health Care in America SUMMARY S-5 Conclusion: Diagnostic and treatment options are expanding and changing at an accelerating rate, placing...

Ngày tải lên: 28/06/2014, 20:20

381 142 0
Is Ho Chi Minh city a much better place to live in today ppt

Is Ho Chi Minh city a much better place to live in today ppt

... of transportation, tuition fees accommodation and a variety of private services such as tailoring, hairdressing, renovating, etc here are all much higher than the so-called standard legal income ... just earn enough money to be physical beings, not emotional or spiritual beings Its increasing crime and disorder also makes Ho Chi Minh City a worse place to live in today than ten years ago A number ... simple but respectable life here I not dare to break any official law or well-established social rule And I often jeer sarcastically at myself, saying how foolish I am in such a crazy, disorderly...

Ngày tải lên: 21/07/2014, 20:20

7 607 0
Báo cáo y học: " High sensitivity C-reactive protein is associated with lower tibial cartilage volume but not lower patella cartilage volume in healthy women at mid-life" pdf

Báo cáo y học: " High sensitivity C-reactive protein is associated with lower tibial cartilage volume but not lower patella cartilage volume in healthy women at mid-life" pdf

... the variance of cartilage volume Statistical analysis The analytical approach used in this analysis was linear regression with total tibial and patella cartilage volumes as the dependent variables ... presented in Tables and For tibial cartilage volume, the variables of particular interest from the univariate analysis included bone area, age and ln hsCRP For the patella cartilage volume, the variables ... contributions FH was responsible for data collection and analysis and interpretation of the data RB was responsible for analysis and interpretation of the data AW performed data analysis FC and SDavis were...

Ngày tải lên: 09/08/2014, 10:23

7 360 0
báo cáo khoa học: "Full recovery of a 13-year-old boy with pediatric Ramsay Hunt syndrome using a shorter course of aciclovir and steroid at lower doses: a case report" pot

báo cáo khoa học: "Full recovery of a 13-year-old boy with pediatric Ramsay Hunt syndrome using a shorter course of aciclovir and steroid at lower doses: a case report" pot

... starting to heal (Table 1) On presentation, he denied headache, vomiting, earache, ever having a hot body or impaired hearing, but he admitted to feeling nauseous and having occasional itchiness ... House-Brackmann facial nerve grading system (ranging from I to VI, with I indicating normal function and VI indicating total paralysis) The rest of the examination was unremarkable (otoscopy was not performed) ... questioning, our patient admitted having had chicken pox about three months previously; he had no prior vaccination against varicella zoster virus Based on the history and physical examination, Ramsay...

Ngày tải lên: 10/08/2014, 22:24

4 275 0
Báo cáo khoa học: " Respiratory viral infections detected by multiplex PCR among pediatric patients with lower respiratory tract infections seen at an urban hospital in Delhi from 2005 to 2007" docx

Báo cáo khoa học: " Respiratory viral infections detected by multiplex PCR among pediatric patients with lower respiratory tract infections seen at an urban hospital in Delhi from 2005 to 2007" docx

... GATTACTCATAGCTGCAGAAG G GATCCACTGTGTCACCGCTCA ATACC CTGAGTGGATATTTGGAAGTG ACCTGG AAGCATGCTATATTAAAAGAGT CTCA 197 bp 266 bp 440 bp ATTATGGGTGTGTCTGGTGCT GA AAGCAAATGGAGTGGATGTAA CAAC CTCCTAATCACAGCTGTAAGA CCCA ... CCCA CAAACTATGTGGTATGCTATTA ATCA ACACAGTATTATCATCCCACA GTC AGGYWCTYATGGARTGGCTAA AG 260 bp 328 bp 105 bp GCAGTCCYCGCTCASTGGGC GGAGAAGGCAAAGCAGAACTA GC CCATTCCATTCATTGTTTTTGC TG TCA TCC ATG ACAACT ... gene Inf AF Inf AR Influenza B matrix gene Inf BF Inf BR GAPDH primers ACCATAGGCATTCATAAACAA TC TCTGGCGGAGGAGCAATTATA CCTGG 84 bp ATCTGCATCATCTGTCACACT CGGGC GATGACACTCCAGTACCTCTT G GATTACTCATAGCTGCAGAAG...

Ngày tải lên: 12/08/2014, 04:22

11 275 0
an action research on methods to improve students’ confidence in speaking english at nguyen ba ngoc lower secondary school = nghiên cứu hành động nhằm nâng cao khả năng tự tin trong tiếng anh của học sinh lớp 9

an action research on methods to improve students’ confidence in speaking english at nguyen ba ngoc lower secondary school = nghiên cứu hành động nhằm nâng cao khả năng tự tin trong tiếng anh của học sinh lớp 9

... five main stages: diagnosing, action planning, taking action, evaluating, specifying learning 2.8.1 Phrase 1: Diagnosing - Personal class observation and talks with the colleagues were made to ... learner learns and uses languages, shares information and negotiates meaning CLT features more interaction- based activities, such as roleplays and information gap tasks Pair work and group work are ... which we find ourselves: Interactive, partially interactive, and Non-interactive Interactive speaking situations include face-to-face conversations and telephone calls, in which we are alternately...

Ngày tải lên: 02/03/2015, 14:25

71 813 3
Tiểu luận môn kinh doanh quốc tế The Not-So-Wonderful World of EuroDisney—Things Are Better Now at Disneyland Resort Paris

Tiểu luận môn kinh doanh quốc tế The Not-So-Wonderful World of EuroDisney—Things Are Better Now at Disneyland Resort Paris

... c a cho du khách châu Âu Nằm cạnh sông Marne, cách Paris khoảng 20 dặm ph a đông, thiết kế công viên lớn xa hoa Công ty Walt Disney (Disney) xây dựng nay, lớn Disneyland Anaheim, California; ... cáo thay đổi sang đóng phim Zorro, kiểu yêu thích người Pháp, Mary Poppins, Alladin, góp mặt phim thành công tạo doanh thu khổng lồ Một chiến dịch in quảng cáo vào thời điểm đóng phim Alladin, ... bắt tay vào tham vọng phát triển kế hoạch Năm 2001, công viên California Adventure thêm vào khu phức hợp Anaheim với giá 1.4 tỷ đô la Walt Disney Studios Theme Park thêm vào Disneyland Paris...

Ngày tải lên: 21/03/2015, 19:54

26 2,1K 10
w