a terminological simplification transformation

... [3] Codd,E.F. A Relational Model of Data for Large Shared Data Banks. CACM 13(6), June, 1970. [4] Barbara Grosz, Douglas E. Appelt, Paul Martin, and Fernando Pereira. TEAM: An Experiment ... Ramshaw and Varda Shaked - for the many pleasant and productive interactions I have had with them. References [1] Bates, Madeleine and Bobrow, Robert J. A Transportable Natural Language Interface ... final simplification is: 244 A Terminological Simplification Transformation for Natural Language Question-Answering Systems David G. Stallard BBN Laboratories Inc. I0 Moulton St. Cambridge,...

Ngày tải lên: 21/02/2014, 20:20

Ngày tải lên: 03/01/2014, 19:44

... way, way out of hand. There was once an ambitious database project called Omega, for instance, that was as glorious as it was impossible to actually build. What we know today as Microsoft Access ... that high ideals are wholly unattainable. Either way you simply stop growing. Few lessons in life are more critical than this one. As I said earlier, it was an act of grace that it came at a ... was that finding a job in this field was about as easy as becoming a starting NFL quarterback. Not very promising to someone who was already engaged to be married and talking about houses and...

Ngày tải lên: 14/03/2014, 20:20

... Transformation- Based Learning, In: Proceedings of CoNLL-99, Bergen. Brill, Eric. 1995. Transformation- Based Error- Driven Learning and Natural Language Process- ing: A Case Study in Part ... learner 2. In each case, the ac- curacy of the resulting sequence of rules was measured on a test corpus consisting of 40k words, with an initial-state accuracy of 93.3~. The following table ... traverses the frequency listing, keeping track of a leading rule and its score. The score of a rule is calculated as the difference between the number of its positive instances and its negative...

Ngày tải lên: 24/03/2014, 03:20

Ngày tải lên: 22/06/2014, 23:20

... the changes in life. However, we can always choose to change for the better. We can always change for personal and spiritual growth. Here are a few areas we can change: 1. Our attitude ... not have such faith? After all, there are many examples of people who choose to follow this path and each of them has been able to achieve the joy and happiness that is seek. FEAR Fear ... becomes easier. In my daily meditation practice, which lasts between 30 minutes and one hour, I also use a revolutionary audio CD that uses binaural beats as an adjunct to my practice....

Ngày tải lên: 15/12/2013, 06:15

Ngày tải lên: 03/01/2014, 19:50

... ta cần có, perhaps the most important one, is called relational capital. cũng có lẽ là loại giữ vai trò quan trọng nhất, nguồn lực vốn quan hệ. A transformational leader has relational capital. ... thứ ba mà transformational leaders always have. bất kỳ vị lãnh đạo thuyết phục thay đổi nào cũng có, It's called reputational capital. Nó được gọi là vốn uy tín. I mean I'll bet that ... themselves in a tự buông mình, cho phép chính mình deeper and a wider and a more lasting way. tham gia sâu sát hơn, bao quát hơn và lâu dài hơn. The key action for a transformational leader Hành...

Ngày tải lên: 24/01/2014, 07:20

... company's financial ratios used in the valuation are shown in table 3. Table 3: Values of financial ratios for 2009 CAM Pastor Bankinter Sabadell Banesto Popular Average Standar d ... analytical network process (Aragonés, Aznar, Ferris & Garc a- Melón, 2008, Garcia-Melón, Ferrís-Oñate, Aznar-Bellver, Aragonés-Beltrán & Poveda-Bautista, 2008) and a combination of several ... regression analysis, require a comprehensive database of comparable assets. In numerous cases the available database is not large enough, as is a common problem in the case of business valuation....

Ngày tải lên: 06/03/2014, 10:20

... chapter a graph grammar formalism based on the notions of relational graph grammars (Rajlich 1975) and attributed programmed graph grammars (Bunke 1982) is developed for parsing languages with ... SEMANIIC PARSING AS GRAPH LANGUAGE TRANSFORMATION - A MULIIDIMENSIONAL APPROACH TO PARSING HIGHLY INFLECTIONAL LANGUAGES Eero Hyv~nen He]sJnkJ IJniversity of TechnoloQy DiaJtal SysLems Laboratory ... c-graphs is under developement. We feel that the idea of seeing parsing as a multidimensional transformation of relational graphs in stead of as a delinearization process of a string into a...

Ngày tải lên: 17/03/2014, 19:21

... that natural phenomena can be observed by the researcher as a detached, objective analyst – carrying out experiments and drawing generalisable conclusions based on mostly quantifiable data. ... configuration school considers strategy as a process of transformation – organizations consist of clusters of different states, characteristics and behaviour and change happens through transformation ... European Paper Industries Containerboard Case materials (fluting and liner) used primarily for transport packaging of durable and non-durable consumer products Corrugated board Multilayer transport...

Ngày tải lên: 18/03/2014, 02:20

... Srivastava DN, Perkas N, Gedanken A, Felner I (2002) J Phys Chem B 106:1878. doi:10.1021/jp015532w 26. Hashimotoa H, Yokoyamab S, Asaokaa H, Kusanoc Y, Ikedad Y, Senoe M, Takadaa J, Fujiia T, Nakanishia ... gradual transformation of phase and morphology from Fe 3 O 4 to a- FeOOH was clearly observed. Experimental F127 was obtained from Sigma-Aldrich. All other chemi- cals were of analytical grade and ... observations (TEM; Model JEM- 1230, JEOL, Tokyo, Japan) were made at an accelerating Y. Yang Á J S. Jiang (&) Department of Physics, Center of Functional Nanomaterials and Devices, East China...

Ngày tải lên: 19/03/2014, 16:48

... Warrant officers are managed according to the Warrant Officer Management Act, which was passed as part of the National Defense Authorization Act for Fiscal Years 1992 and 1993. 16 See Fernandez ... HEALTH CARE INTERNATIONAL AFFAIRS NATIONAL SECURITY POPULATION AND AGING PUBLIC SAFETY SCIENCE AND TECHNOLOGY SUBSTANCE ABUSE TERRORISM AND HOMELAND SECURITY TRANSPORTATION AND INFRASTRUCTURE WORKFORCE ... receive retirement pay (DoD, 200 2a) . 22 For a detailed overview of the advantages and disadvantages of the military retirement system, see Asch and Warner (199 4a, 1994b) and Asch, Johnson, and Warner (1998). -...

Ngày tải lên: 23/03/2014, 02:20

... ATTAAGGAGCTTCGGGAGATG Exon 7 380 P558 CTCTTATACCCAATGCTGCTG Exon 10 CYP1 1A First pair P561 GCCTTTGAGTCCATCACTAAC Exon 4 628 P562 CCAGTGTCTTGGCAGGAATC Exon 8 Nested pair P563 ATGTGGCTGCATGGGACGTG ... control placenta, whole human skin, normal epidermal and immor- talized keratinocytes, dermal fibroblasts, squamous cell carcinoma and five human melanomas. Thus, these data clarify in detail the cutaneous ... 390 P564 TCTGCAGGGTCACGGAGATG Exon 7 Mouse genes FDX1 P581 AAATTGGCGACTCTCTGCTAG Exon 2 295 P582 CTTGCTCATGTCAACAGACTG Exon 4 FDXR P583 CTTGGAGTCATCCCCAACAC Exon 10 281 P584 TGGCCTCGAGAGACTTCCTC Exon...

Ngày tải lên: 23/03/2014, 13:20

... minutes. Drain and transfer to a large bowl. Meanwhile, place the frozen squash and milk into a large saucepan and cook over a low heat, stirring occasionally and breaking up the squash with a spoon ... entire batch is ready. When all the pancakes are ready, cut them into heart shapes with a heart shaped cookie cutter. Ladle about 1/3 cup of the strawberry sauce onto each plate, place pancakes ... whole-wheat pastry flour  1 teaspoon baking soda  1/2 teaspoon salt  3 tablespoons agave nectar  1/2 teaspoon ground cinnamon  1/2 cup chopped raw walnuts  1/2 cup organic sucanat  2 tablespoons...

Ngày tải lên: 23/03/2014, 17:21

... twenty Administrative Villages of Menglong Township, Baka Administrative Village is consisted of eight natural villages—4 Akha (Baka, Bohe, Pisha, Bahanhuang), 3 Han and Hani (Nasha Yidui, Nasha ... of Traditional Akha in Myanmar (ATAM), there is about 250,000 Akha in Myanmar. But, Mr. Artseir Ghoeqlanq, an Akha cultural expert from Kengtung, Shan State, informed that the Akha population ... cultural festivals (e.g., Akha new year festival or Kartanrpar), but also celebrate them at larger scales. Improved living standards have also liberated Akha women from many heavy traditional duties...

Ngày tải lên: 23/03/2014, 21:22

Ngày tải lên: 31/03/2014, 06:20

Ngày tải lên: 08/06/2014, 09:07