... amongst Canadian family practitioners, who manage the bulk of care for these patients [2] Unfortunately, there remains a large gap between ideal and actual care provided to such patients, making them ... that data quality from EMRs are uncertain [70] While we have validated algorithms for identifying patients who have diabetes and/or IHD in this database, the automated chart audits that are the ... capitation plays a large role in compensation for patient care To earn the capitation fees, physicians and patients must co-sign an agreement that officially adds the patient to the physician’s...
Ngày tải lên: 10/08/2014, 10:23
... the axial coding phase into a coherent model or theory, usually based on a core or central category from the data Based on the pattern of passages examined during axial coding, the "customizability" ... customizability engages the individual with the data, making him/her an active participant in the sense-making process, rather than a passive recipient of information The proposed hierarchical ordering ... assumes that the data fed back to the clinician are valid and reliable Issues of sample size (whether sufficient cases of a given indicator exist to calculate a stable estimate for an individual provider),...
Ngày tải lên: 11/08/2014, 05:22
Using Flash and ActionScript 3.0
... will add that text field to the stage The stage is the display area of a Flash movie You can arrange elements on the stage while authoring a movie During playback, the stage is the area the user ... break the game into smaller and smaller tasks (and take each one step at a time), you can create any game A simple whack -a- mole game might require fewer than a hundred tasks, whereas a complex platform ... back at Figure 1.10, you can see that there are four layers The first layer, Label, contains three keyframes The way you create frames and keyframes is to use F5 to add a frame to a layer, and...
Ngày tải lên: 29/09/2013, 19:20
Fundamental Analysis - Tools and Tactics
... overall market (By the way, pay attention to the P/E of the entire market For years, the P/E of the S&P 500 was hovering above 30, a clue that the market was overvalued Some analysts believe that ... Unfortunately, finding out how much a company really earns is not as easy as it appears Some CEOs will play a number of accounting tricks to make it appear that earnings are stronger than they ... correctly value a company Professional money managers hire teams of analysts to fundamental research on individual companies before they make a stock purchase Individual investors have to rely on biased...
Ngày tải lên: 24/10/2013, 08:20
Technical Analysis - Tools and Tactics
... displayed as a line that moves forward with each trading day When moving averages are put on a chart, they give technicians a lot of clues about where a stock is headed Many technical analysts ... 50-day MA and the 200-day MA In Figure 12-1, for much of the period shown, Caterpillar remained well below its 50-day and 200-day MA Near the end of August, it bumped up against the 50-day MA before ... seen as bearish and is a signal to sell In particular, many institutional investors use the 200-day MA as support and resistance For example, if the stock price is trading below the 200-day MA,...
Ngày tải lên: 24/10/2013, 08:20
Analysis, sequencing and in vitro expression of PCR products
... TGGGCTATAGACTTCGCCATTCTTCTCAAATACGCCACCGCTCCAGGAGCCTCCAATGGTAAAAACACGACCGTCTGACATGC 180 190 200 210 220 230 240 250 (C) GTAGCTGATGACTGATACCCACGAGCCACTTGCATGTCAGGTCCCGGGATCCAGCTATCGCTAGATGAATCATACAAACT ... translation initiation sequence For example the sequences: ● GAATTCTAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATA CATATG [1] ● CCAAGCTTCTAATACGACTCACTATAGGGTTTTTATTTTTAATTTTCTTT CAAATACTTCCACCATG [2] could ... GCAGACACAGAATGGGACAAAGG 5’ G T G G T G 3’ C C T T GAATGGGACAAAGGAGAACACG 5’ G T G G G T 3’ C T Figure 5.2 Design of degenerate primers from amino acid sequence data The primer mix for initial...
Ngày tải lên: 25/10/2013, 22:20
Essential Technical Analysis - Tools And Techniques To Spot Market Trends
Ngày tải lên: 26/10/2013, 16:15
Data Analysis, Statistics, and Probability
... represents a decrease A flat line indicates no change as time elapses ase cre De The GED exam will test your ability to analyze graphs and tables Read each graph or table very carefully before reading the ... event by adding the known probabilities together and subtracting their total from – DATA ANALYSIS, STATISTICS, AND PROBABILITY – Graphs and Tables Inc rea se se rea Inc se a re Circle graphs or ... times a number x by ten y = 5x + 10 Inequality signs are used for at least and at most, as well as less than and more than The product of x and is greater than x×6>2 Ratio A ratio is a comparison...
Ngày tải lên: 02/11/2013, 17:20
Interval analysis theory and applications g otz alefelda g unter mayerb
... Ä d [a] = a − a; | [a] | = max{ |a| |a ∈ [a] } = max{ |a| ; |a| }; [a] = min{ |a| |a ∈ [a] } = 0; if ∈ [a] ; min{ |a| ; |a| } if ∈ [a] = (10) and call a center, d [a] diameter and | [a] | absolute value of [a] ... Sunaga, Theory of an interval algebra and its application to numerical analysis, RAAG Memoirs (1958) 29–46 [89] W.V Walter, FORTRAN-XSC: a portable FORTRAN 90 module library for accurate and ... recall that A ∈ Rn×n is an M matrix if aij 60 for i = j and if A 1 exists and is nonnegative, i.e., A 1 ¿O If each matrix A from a given interval matrix [A] is an M matrix then we call [A] an...
Ngày tải lên: 12/01/2014, 22:05
Tài liệu FINANCIAL ANALYSIS: TOOLS AND TECHNIQUES:A Guide for Managers ppt
... examples are presented in this readily accessible format to ease the mechanical aspects of analysis An entirely new feature is the optional availability of the advanced, knowledge-based financial analysis ... available to generate quantitative answers Selecting the appropriate tools from these choices is clearly an important part of the analytical task Yet, experience has shown again and again that ... current and future economic performance and value Therefore, the manager or analyst must at all times carefully interpret and even translate the available data to properly match the context and purpose...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu India’s Undernourished Children: A Call for Reform and Action doc
... Tripura Arunachal Pradesh Uttar Pradesh West Bengal Tamil Nadu Rajasthan Punjab Orissa Nagaland Mizoram Meghalaya Manipur Maharashtra Madhya Pradesh Kerala Karnataka Jammu and Kashmir Haryana Gujarat ... Pradesh Uttar Pradesh Tamil Nadu Urban % change 92-98 West Bengal Rajasthan Orissa Punjab Nagaland Mizoram Meghalaya Manipur Maharashtra Kerala Madhya Pradesh Karnataka Jammu & Kashmir Haryana ... Goa Mizoram Assam Manipur West Bengal Sikkim Jammu & Kashmir Tripura Meghalaya Kerala Orissa Tamil Nadu Arunachal Pradesh Delhi Maharashtra Andaman & NicobarIslands Haryana Pondicherry Lakshadweep...
Ngày tải lên: 12/02/2014, 12:20
Tài liệu Creative Business: Achieving Your Goals Through Creative Thinking and Action pptx
... with their natural inclinations They choose them as a safe bet, a low risk option that is taken on the basis of availability, an attractive starting salary or simply to emulate the career path ... from the norm, a chance to stop for once and relax along with the rest of the population As we approach each New Year, a tiny part of our brains starts to prepare for a fresh start and a subtle ... and the publication of performance statistics, whatever merits these initiatives may have Force-feeding students, so that they can simply regurgitate the facts and achieve the results the teachers...
Ngày tải lên: 18/02/2014, 03:20
Tài liệu ADSORPTION ANALYSIS: EQUILIBRIA AND KINETICS doc
... present the Gibbs thermodynamics approach This approach treats the adsorbed phase as a single entity, and Gibbs adapted the classical thermodynamics of the bulk phase and applied it to the adsorbed ... size for activated carbon is reported as the micropore half-width rather than radius as in the case of alumina or silica gel The arrangement of carbon atoms in the graphitic structure is similar ... 6.14 Two atoms or molecules interaction An atom or molecule and a lattice plane An atom or molecule and a slab A species and two parallel lattice planes A species and two parallel slabs Adsorption...
Ngày tải lên: 19/02/2014, 17:20
financial analysis tools and techniques 2012 pot
... examples are presented in this readily accessible format to ease the mechanical aspects of analysis An entirely new feature is the optional availability of the advanced, knowledge-based financial analysis ... available to generate quantitative answers Selecting the appropriate tools from these choices is clearly an important part of the analytical task Yet, experience has shown again and again that ... current and future economic performance and value Therefore, the manager or analyst must at all times carefully interpret and even translate the available data to properly match the context and purpose...
Ngày tải lên: 05/03/2014, 20:20
Network Security Protocols: Analysis methods and standards potx
... Masquerading and Malicious AP Easy, MAC address forgeable and s/w available (HostAP) Session Hijacking Man-in -the- Middle Denial-of-Service: cost related evaluation 19 4-Way Handshake Blocking AA, ANonce, ... People can an acceptable job, eventually Systematic methods improve results Practical case for software verification Even for standards that are widely used and carefully reviewed, automated tools ... Authentication MSK 4-Way Handshake Group Key Handshake Data Communication 18 Changhua He Wireless Threats Passive Eavesdropping/Traffic Analysis Easy, most wireless NICs have promiscuous mode Message...
Ngày tải lên: 05/03/2014, 21:20
Business Process Analysis Worksheets and Guidelines: Procedures for Developing Business Processes in ebXML v1.0 docx
... to have a set of instructions that augment the templates and provide some of the rationale behind the templates A template is a document or file having a preset format that is used as a starting ... relevant to the use case and a definition of their goals Non-functional requirements may be a source of performance goals For each performance goal, provide a name of the performance goal and a ... really result in an economic consequence Be sure to validate the information in the process area against the encompassing business area For example, validate that the scope of the process area...
Ngày tải lên: 06/03/2014, 20:21
USDA Findings and Actions Report Table of Contents pot
... General perform an audit to evaluate the adequacy of USDA's coordination and control processes for the beef export verification program for Japan Atlantic Veal and Lamb, Inc (Atlantic) was the ... to the U.S., even with the SRM’s in them The U.S should have made the same case to the Japanese all along about American veal, but unlike the Canadian government, which cares about their veal ... established for the quality management system Hazard Analysis and Critical Control Point (HACCP) is a systematic approach to food safety that addresses ~bysical,chemical, and biological hazards...
Ngày tải lên: 06/03/2014, 23:20