a syntactic and lexical based discourse segmenter
Báo cáo khoa học: "A Syntactic and Lexical-Based Discourse Segmenter" pdf
... of a standard parser. The pur-pose of this paper is to describe our syntactic and lexical- based segmenter (SLSeg), demonstrate itsperformance against state-of-the-art systems, and make it available ... Organization. Text, 8:243–281.Daniel Marcu. 2000. The Theory and Practice of Discourse Parsing and Summarization. MIT Press,Cambridge, MA.Rebecca J. Passonneau and Diane J. Litman. 1997. Discourse ... Segmentation by Human and AutomatedMeans. Computational Linguistics, 23(1):103–139.Rashmi Prasad, Nikhil Dinesh, Alan Lee, AravindJoshi and Bonnie Webber. 2006. Attribution and itsAnnotation...
- 4
- 337
- 0
LabelMe: a database and web-based tool for image annotation pdf
... eutherian, eutherian mammal; mammal, mammalian; ver-tebrate, craniate; chordate; animal, animate being, beast, brute, creature, fauna; organism, being; living thing,animate thing; object, physical ... see that a large collection of labeled data allows us to extract interesting information2LabelMe: a database and web -based tool for imageannotationBryan C. Russell∗, Antonio Torralba∗Computer ... (656).7evaluation. To achieve this, we developed a web -based tool that allows easy image annotation and instant sharing of such annotations. Using this annotation tool, we have collected a largedataset...
- 33
- 515
- 1
Tài liệu Báo cáo khoa học: "A Large Scale Distributed Syntactic, Semantic and Lexical Language Model for Machine Translation" doc
... Stochastic analysis of lexical and semantic enhanced structural language model. The 8thInternational Colloquium on Grammatical Inference(ICGI), 97-111.K. Yamada and K. Knight. 2001. A syntax -based ... signif-icantly. Bear in mind that Charniak et al. (2003) in-tegrated Charniak’s language model with the syntax- based translation model Yamada and Knight pro-posed (2001) to rescore a tree-to-string ... standard MapReduce paradigm (Dean and Ghemawat, 2004): the corpus is first divided and loaded into a number of clients, and n-gram countsare collected at each client, then the n-gram countsmapped and...
- 10
- 567
- 0
Báo cáo khoa học: "Using Lexical Dependency and Ontological Knowledge to Improve a Detailed Syntactic and Semantic Tagger of English" pot
... resampling.ReferencesE. Black and A. Finch. 2001. Developing and prov-ing effective broad-coverage semantic -and -syntactic tagsets for natural language: The atr approach. InProceedings of ICCPOL-2001.E. Black, ... information isnot available to the tagger. The automatic cluster-ing has been trained on 100 times as much dataas our tagger, and therefore will have informationabout words that tagger has not seen ... and therebyglean knowledge about rare words. In these exper-iments we use the human annotated word taxon-omy of hypernyms (IS -A relations) in the Word-Net database, and an automatically acquired...
- 8
- 423
- 0
A STUDY ON LEXICAL COHESION IN VIETNAMESE AND ENGLISH CORPORATE ADVERTISINGS
... usedChild careCare programHealthcare ITHealthcare professionalsHealthcare productsHealthcare solutionsHealthcare processHealthcare providersHealthcare goalsHealthcare programHealthcare marketHealth ... information to have an overview of the operation and organizational structure. As a matter of fact, the advertisements are almost in English that is regarded as an international language. How ... collocation as a word that keeps a family of words collocated with each other. This leads to the notion of lexical phrases, certain phrases that always appear in the same form, such as by pure...
- 41
- 1,094
- 2
Tài liệu Báo cáo khoa học: "Discourse Relations: A Structural and Presuppositional Account Using Lexicalised TAG*" docx
... syntax and semantics and that of the clause. References Nicholas Asher and Alex Lascarides. 1999. The semantics and pragmatics of presupposition. Journal of Semantics, to appear. Dan Cristea ... additional semantic relations and modal operators to be conveyed through anaphoric presuppositions (Van der Sandt, 1992) licensed by information that speaker and hearer are taken to share. A main ... a lexicalized TAG, each elementary tree has at least one anchor. In the case of discourse, the an- chor for an elementary tree may be a lexical item, punctuation or a feature structure that...
- 8
- 415
- 0
Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc
... states that repairs are available for semantic analysis but provides no details on the representation to be used. Clearly repairs should be available for se- mantic analysis as they play a ... the input, and this view is readily imple- mentable. The repair metarule, when given the hypo- thetical start and end of a reparandum (say from a language model such as (Heeman and Allen, 1997)), ... of machine translators and meeting analysis programs that deal with human-human dialog. Speech recognizers have started to adapt to spoken dialog (ver- sus read speech). Recent language mod-...
- 8
- 486
- 0
Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx
... relationship between 'sales' and the three tokens of 'of': Example 2 Shaw, based in Dalton, Ga., has an- nual sales of about $1.18 billion, and has economies of scale and ... lower raw-material costs that are ex- pected to boost the profitability of Armstrong's brands, sold under the Armstrong and Evans-Black names . In this sentence 'sales' and 'of' ... 'distance' variable, A, and extending C, F and /~ to include this variable. For example, C( (a, b), (c, d), A) is the number of times (a, b) and (c, d) appear in the same sentence at a distance...
- 8
- 320
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CTCACCACAGACGATWTCCPLA5G2 (F) CGGTAAGCCCATAACGCCCAPLA3G2 (R) CAGGCCAGGATTTGCAGCCPLA3G4 (R) CATAAACAYGAGCCAGTTGCCARTF a (F) GAGTGGATGCACAGTCGTTGARTR a (R) GAAACGGAGGTAGTGACACATAtxBFb(F) GCCTGCTCGAATTCGGGATGAtxBrcb(R) ... GCCTGCTCGAATTCGGGATGAtxBrcb(R) CTCCTTCTTGCACAAAAAGTGAtxACFc(F) CTGCTCGAATTCGGGATGAtxACrcc(R) GTCYGGGTAATTCCTATATAAmlFd(F) GTGATCGAATTTGGGAAGATGATCCAAmlrcd(R) CCCTTGCATTTAAACCTCAGGTACAC a Specific ... (F)CCCTATAGTGAGTCGTATTAT7 Promoter (R) CAGGAAACAGCTATGACPLA5G (F) CGGAATTCTGAAGGTGGCCCGCCAGGTGACAGPLA3G (R) CGCGGATCCAATCTTGATGGGGCAGCCGGAGAGGPLA5G1 (F) AGGAYTCTCTGGATAGTGGPLA3G1 (R) CTCACCACAGACGATWTCCPLA5G2...
- 10
- 451
- 0
Báo cáo khoa học: "Paragraph-, word-, and coherence-based approaches to sentence ranking: A comparison of algorithm and human performance" ppt
... different approaches to sentence ranking: A simple paragraph -based approach intended as a baseline, two word -based approaches, and two coherence -based approaches. In the paragraph -based approach, ... the Wall Street Journal. Our results indicated that a simple paragraph- based algorithm that was intended as a baseline performed very poorly, and that word -based and some coherence -based algorithms ... simple paragraph -based approach that serves as a baseline, two word -based algorithms, and two coherence- based approaches1. We furthermore evaluated the MSWord summarizer. 2 Approaches to...
- 8
- 415
- 0
Báo cáo khoa học: "Towards a Unified Approach to Memory- and Statistical-Based Machine Translation" pdf
... Machine trans-lation with a stochastic grammatical channel. InProceedings of ACL’98, pages 1408–1414, Mon-treal, Canada.Kenji Yamada and Kevin Knight. 2001. A syntax- based statistical translation ... Global Age. John Benjamins Publishers.Tony Veale and Andy Way. 1997. Gaijin: A template -based bootstrapping approach to example- based machine translation. In Proceedings of “NewMethods in Natural ... translation model and a de-scription of its parameters.3 Building a statistical translationmemoryCompanies that specialize in producing high-quality human translations of documentation and news...
- 8
- 433
- 0
Báo cáo khoa học: Prediction of coenzyme specificity in dehydrogenases ⁄ reductases A hidden Markov model-based method and its application on complete genomes doc
... in archaea the top and bottom is rep-resented by Haloarcula marismortui (146 proteins) and Nanoarchaeum equitans (five proteins). The genomes ofOryza sativa and Xenopus tropicalis have many ... 15%,respectively. The bacterial genome of Chlamydophilacaviae also show a dual sites proportion of 15%, whilethe archeal genomes of Thermococcus kodakaraensis and Nanoarchaeum equitans show 17 and 20%, respect-ively. ... coenzyme preference among archaean, bacterial, and eukaryotic genomes.Kingdom FAD NAD NADPArchaea 0.21 0.49 0.30Bacteria 0.21 0.46 0.33Eukaryota 0.21 0.41 0.38Y. Kallberg and B. Persson Prediction...
- 8
- 481
- 0
Báo cáo khoa học: "Online Plagiarism Detection Through Exploiting Lexical, Syntactic, and Semantic Information" potx
... Sentence A pre-defined resemblance function based on word correlation factor. Stamatatos, 2011 Passage Overlap percentage of stopword n-grams. Grman and Ravas, 2011 Passage Matching ... normalized term, which is the maximum possible distance between S1 and S2, then the reordering 1467. References Salha Alzahrani, Naomie Salim, and Ajith Abraham, “Understanding Plagiarism ... Phan and Cam-Tu Nguyen. GibbsLDA++: A C/C++ implementation of latent Dirichlet allocation (LDA), 2007 Martin Potthast, Benno Stein, Alberto Barrón Cedeño, and Paolo Rosso. An Evaluation Framework...
- 6
- 382
- 0
- product of a vector and a scalar
- a tool for community based environment education
- mushroom cultivation both a science and an art
- a semantics and pragmatics
- a fragment and an implementation
- a syntactic and lexicalbased discourse segmenter
- a syntactic and semantic analysis of turkish nominal compounds
- a syntactic semantic and pragmatic analysis of conjunction
- a model of lexical attraction and repulsion
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25