a syntactic and lexical based discourse segmenter

... of a standard parser. The pur- pose of this paper is to describe our syntactic and lexical- based segmenter (SLSeg), demonstrate its performance against state-of-the-art systems, and make it available ... Organization. Text, 8:243–281. Daniel Marcu. 2000. The Theory and Practice of Discourse Parsing and Summarization. MIT Press, Cambridge, MA. Rebecca J. Passonneau and Diane J. Litman. 1997. Discourse ... Segmentation by Human and Automated Means. Computational Linguistics, 23(1):103–139. Rashmi Prasad, Nikhil Dinesh, Alan Lee, Aravind Joshi and Bonnie Webber. 2006. Attribution and its Annotation...

Ngày tải lên: 23/03/2014, 17:20

... eutherian, eutherian mammal; mammal, mammalian; ver- tebrate, craniate; chordate; animal, animate being, beast, brute, creature, fauna; organism, being; living thing, animate thing; object, physical ... see that a large collection of labeled data allows us to extract interesting information 2 LabelMe: a database and web -based tool for image annotation Bryan C. Russell ∗ , Antonio Torralba ∗ Computer ... (656). 7 evaluation. To achieve this, we developed a web -based tool that allows easy image annotation and instant sharing of such annotations. Using this annotation tool, we have collected a large dataset...

Ngày tải lên: 07/03/2014, 23:20

Ngày tải lên: 26/11/2013, 13:23

... Stochastic analysis of lexical and semantic enhanced structural language model. The 8th International Colloquium on Grammatical Inference (ICGI), 97-111. K. Yamada and K. Knight. 2001. A syntax -based ... signif- icantly. Bear in mind that Charniak et al. (2003) in- tegrated Charniak’s language model with the syntax- based translation model Yamada and Knight pro- posed (2001) to rescore a tree-to-string ... standard MapReduce paradigm (Dean and Ghemawat, 2004): the corpus is first divided and loaded into a number of clients, and n-gram counts are collected at each client, then the n-gram counts mapped and...

Ngày tải lên: 20/02/2014, 04:20

... resampling. References E. Black and A. Finch. 2001. Developing and prov- ing effective broad-coverage semantic -and -syntactic tagsets for natural language: The atr approach. In Proceedings of ICCPOL-2001. E. Black, ... information is not available to the tagger. The automatic cluster- ing has been trained on 100 times as much data as our tagger, and therefore will have information about words that tagger has not seen ... and thereby glean knowledge about rare words. In these exper- iments we use the human annotated word taxon- omy of hypernyms (IS -A relations) in the Word- Net database, and an automatically acquired...

Ngày tải lên: 17/03/2014, 04:20

Ngày tải lên: 07/09/2013, 12:58

Ngày tải lên: 26/11/2013, 13:16

Ngày tải lên: 26/11/2013, 13:16

Ngày tải lên: 26/11/2013, 13:21

Ngày tải lên: 26/11/2013, 13:21

Ngày tải lên: 14/12/2013, 16:45

... used Child care Care program Healthcare IT Healthcare professionals Healthcare products Healthcare solutions Healthcare process Healthcare providers Healthcare goals Healthcare program Healthcare market Health ... information to have an overview of the operation and organizational structure. As a matter of fact, the advertisements are almost in English that is regarded as an international language. How ... collocation as a word that keeps a family of words collocated with each other. This leads to the notion of lexical phrases, certain phrases that always appear in the same form, such as by pure...

Ngày tải lên: 29/01/2014, 10:43

... syntax and semantics and that of the clause. References Nicholas Asher and Alex Lascarides. 1999. The semantics and pragmatics of presupposition. Journal of Semantics, to appear. Dan Cristea ... additional semantic relations and modal operators to be conveyed through anaphoric presuppositions (Van der Sandt, 1992) licensed by information that speaker and hearer are taken to share. A main ... a lexicalized TAG, each elementary tree has at least one anchor. In the case of discourse, the an- chor for an elementary tree may be a lexical item, punctuation or a feature structure that...

Ngày tải lên: 20/02/2014, 18:20

... states that repairs are available for semantic analysis but provides no details on the representation to be used. Clearly repairs should be available for se- mantic analysis as they play a ... the input, and this view is readily imple- mentable. The repair metarule, when given the hypo- thetical start and end of a reparandum (say from a language model such as (Heeman and Allen, 1997)), ... of machine translators and meeting analysis programs that deal with human-human dialog. Speech recognizers have started to adapt to spoken dialog (ver- sus read speech). Recent language mod-...

Ngày tải lên: 20/02/2014, 19:20

... relationship between 'sales' and the three tokens of 'of': Example 2 Shaw, based in Dalton, Ga., has an- nual sales of about $1.18 billion, and has economies of scale and ... lower raw-material costs that are ex- pected to boost the profitability of Armstrong's brands, sold under the Armstrong and Evans-Black names . In this sentence 'sales' and 'of' ... 'distance' variable, A, and extending C, F and /~ to include this variable. For example, C( (a, b), (c, d), A) is the number of times (a, b) and (c, d) appear in the same sentence at a distance...

Ngày tải lên: 08/03/2014, 07:20

... CTCACCACAGACGATWTCC PLA5G2 (F) CGGTAAGCCCATAACGCCCA PLA3G2 (R) CAGGCCAGGATTTGCAGCC PLA3G4 (R) CATAAACAYGAGCCAGTTGCC ARTF a (F) GAGTGGATGCACAGTCGTTG ARTR a (R) GAAACGGAGGTAGTGACACAT AtxBF b (F) GCCTGCTCGAATTCGGGATG AtxBrc b (R) ... GCCTGCTCGAATTCGGGATG AtxBrc b (R) CTCCTTCTTGCACAAAAAGTG AtxACF c (F) CTGCTCGAATTCGGGATG AtxACrc c (R) GTCYGGGTAATTCCTATATA AmlF d (F) GTGATCGAATTTGGGAAGATGATCCA Amlrc d (R) CCCTTGCATTTAAACCTCAGGTACAC a Specific ... (F) CCCTATAGTGAGTCGTATTA T7 Promoter (R) CAGGAAACAGCTATGAC PLA5G (F) CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG PLA3G (R) CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG PLA5G1 (F) AGGAYTCTCTGGATAGTGG PLA3G1 (R) CTCACCACAGACGATWTCC PLA5G2...

Ngày tải lên: 17/03/2014, 03:20

... different approaches to sentence ranking: A simple paragraph -based approach intended as a baseline, two word -based approaches, and two coherence -based approaches. In the paragraph -based approach, ... the Wall Street Journal. Our results indicated that a simple paragraph- based algorithm that was intended as a baseline performed very poorly, and that word -based and some coherence -based algorithms ... simple paragraph -based approach that serves as a baseline, two word -based algorithms, and two coherence- based approaches 1 . We furthermore evaluated the MSWord summarizer. 2 Approaches to...

Ngày tải lên: 17/03/2014, 06:20

... Machine trans- lation with a stochastic grammatical channel. In Proceedings of ACL’98, pages 1408–1414, Mon- treal, Canada. Kenji Yamada and Kevin Knight. 2001. A syntax- based statistical translation ... Global Age. John Benjamins Publishers. Tony Veale and Andy Way. 1997. Gaijin: A template -based bootstrapping approach to example- based machine translation. In Proceedings of “New Methods in Natural ... translation model and a de- scription of its parameters. 3 Building a statistical translation memory Companies that specialize in producing high- quality human translations of documentation and news...

Ngày tải lên: 17/03/2014, 07:20

... in archaea the top and bottom is rep- resented by Haloarcula marismortui (146 proteins) and Nanoarchaeum equitans (five proteins). The genomes of Oryza sativa and Xenopus tropicalis have many ... 15%, respectively. The bacterial genome of Chlamydophila caviae also show a dual sites proportion of 15%, while the archeal genomes of Thermococcus kodakaraensis and Nanoarchaeum equitans show 17 and 20%, respect- ively. ... coenzyme preference among archaean, bacterial, and eukaryotic genomes. Kingdom FAD NAD NADP Archaea 0.21 0.49 0.30 Bacteria 0.21 0.46 0.33 Eukaryota 0.21 0.41 0.38 Y. Kallberg and B. Persson Prediction...

Ngày tải lên: 23/03/2014, 10:21

... Sentence A pre-defined resemblance function based on word correlation factor. Stamatatos, 2011 Passage Overlap percentage of stopword n-grams. Grman and Ravas, 2011 Passage Matching ... normalized term, which is the maximum possible distance between S 1 and S 2 , then the reordering 146 7. References Salha Alzahrani, Naomie Salim, and Ajith Abraham, “Understanding Plagiarism ... Phan and Cam-Tu Nguyen. GibbsLDA++: A C/C++ implementation of latent Dirichlet allocation (LDA), 2007 Martin Potthast, Benno Stein, Alberto Barrón Cedeño, and Paolo Rosso. An Evaluation Framework...

Ngày tải lên: 23/03/2014, 14:20