a survival and resistance mechanism of microorganisms
Báo cáo khoa học: Identification, characterization and activation mechanism of a tyrosine kinase of Bacillus anthracis docx
... orthologs of SalA (BAS0147 and BAS3357, showing similarities of 85% and 65%, respectively), MinD (BAS4346, showing a similarity of 90%) and SojA (BAS5333 and BAB82448, showing similarities of 92% and ... McsB of Bacillus anthracis A R Mattoo et al and Gram-negative bacteria Exopolysaccharides play an important roles in bacterial virulence, suggesting a role for tyrosine kinases in bacterial pathogenesis ... tyrosine kinase and that Tyr155 and Tyr210 are the sites of autophosphorylation A B Fig (A) Autophosphorylation activity of McsB The autophosphorylation activity of McsB was evaluated by incubating...
- 11
- 407
- 0
báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf
... phosphorylating and inactivating proapoptotic factors, such as FKHR and GSK-3β [7] FKHR is a transcription factor that transactivates the expression of death-activating proteins, such as Fas ligand (FasL) ... chemotherapy by means of inactivating apoptotic factors and enhancing survival pathways that antagonize apoptosis signals [2] However, the precise mechanisms of OvCa cell cisplatin-sensitivity or survival ... chemotherapy and a major cause of treatment failure in human OvCa The balance between survival and apoptotic signals determine a cell's sensitivity to chemotherapy Indeed, cancer cells develop resistance...
- 8
- 316
- 0
Tài liệu Báo cáo khoa học: Dmrt1 genes at the crossroads: a widespread and central class of sexual development factors in fish pdf
... meridionalis GnRHa Acanthopagrus schlegeli Direct Transcrip ptional Regula ation Dmrt1 Sox + GATA ? Estrogen Androgen Cyp1 9a1 a Sox Dmrt1bY Cyp1 9a1 a (aromatase) Epinephelus akaara Danio re rio Oryzias ... repression of aromatase transcription, a possible mechanism favoring the male pathway in tilapia Endocrinology 151, 1331– 1340 48 Nakamoto M, Wang DS, Suzuki A, Matsuda M, Nagahama Y & Shibata N (2007) ... 2083–2090 12 Otake H, Masuyama H, Mashima Y, Shinomiya A, Myosho T, Nagahama Y, Matsuda M, Hamaguchi S & Sakaizumi M (2009) Heritable artificial sex chromosomes in the medaka, Oryzias latipes Heredity...
- 10
- 860
- 0
Tài liệu Báo cáo khoa học: A second independent resistance mechanism to Bacillus sphaericus binary toxin targets its a-glucosidase receptor in Culex quinquefasciatus docx
... CGCCAGGGAGCTCACATGCCGTT), and three 3¢ oligonucleotides (primer 3, GAAAAGCTTCAGCTGGAA GTTGAACGGCAT; primer 4, AACAAGCTTCACGAA ATCTCCCAGGTCCAC; primer 7, AACAAGCTTGA AATCTCCCAGGTCCACGGT) were used To facilitate cloning ... quinquefasciatus using Bacillus sphaericus: results of a pilot project in a large urban area of equatorial Africa Bull World Health Organ 71, 367–375 Kumar A, Sharma VP, Thavaselvam D, Sumodan PK, Kamat ... was found to vary from 54 to 76 bp This might be associated with the occurrence of two possible polyadenlyation signals, a consensus AATAAA and a variant AATTAG (Fig 3, in boldface) In the various...
- 13
- 499
- 0
SAVINGS BANKS AND THE DOUBLE BOTTOM-LINE: A profitable and accessible model of finance doc
... size and average savings balances for commercial banks Loan size and average savings balances for savings banks Savings banks’ lending volumes and average loan sizes Loan and savings penetration ... institutions are that loans are available in small sizes and capable of being repaid in small and varying amounts This actually supersedes issues of income and price that are the usual focus of debates about ... there has always been a clear dual mandate to (a) reach a target group not well served by commercial banks but (b) try and make a reasonable profit so that the outreach achieved can be sustained...
- 84
- 382
- 0
Th e Care of Brute Beasts A Social and Cultural Study of Veterinary Medicine in Early Modern England pot
... Swabe, The Burden of Beasts: A Historical Sociological Study of Changing Human-Animal Relations and the Rise of the Veterinary Regime (Amsterdam, 1997) and L Wilkinson, Animals and Disease: An ... Company of Farriers It will also discuss the many other types of animal healers in the marketplace, many of whom appeared to have at least a rudimentary literacy, as well as the large numbers of ... recommended way to this was to have a healthy daily regime based on the Galenic non-naturals of air, motion and rest, sleep and waking, diet, evacuation and retention and the passions However, although...
- 191
- 571
- 0
A POLITICAL AND ECONOMIC DICTIONARY OF LATIN AMERICA ppt
... Caribbean and Central American states The member states are: Antigua and Barbuda, the Bahamas, Barbados, Belize, Colombia, Costa Rica, Cuba, Dominica, Dominican Republic, El Salvador, Grenada, ... Guatemala, Guyana, Haiti, Honduras, Jamaica, Mexico, Nicaragua, Panama, St Christopher and Nevis, St Lucia, St Vincent and the Grenadines, Suriname, Trinidad and Tobago, and Venezuela There are ... states agreed to establish a regional secretariat in Brasília and signed the Lima Declaration on sustainable development Andean Community of Nations Comunidad Andina de Naciones (CAN) The Andean Pact,...
- 315
- 758
- 0
A POLITICAL AND ECONOMIC DICTIONARY OF THE MIDDLE EAST potx
... Kabol, Kandahar, Kapisa, Khowst, Konar, Kondoz, Laghman, Lowgar, Nangarhar, Nimruz, Nurestan, Oruzgan, Paktia, Paktika, Parvan, Samangan, Sar-e Pol, Takhar, Vardak, and Zabol The population is ... political scene A political and economic dictionary of the middle east 22 Al-Ahbash The Association of Islamic Charitable Projects (Jami’at al-Mashari’ al-Khayriya alIslamiyya), known as al-Ahbash ... 1995 An anti-Islamist party, it is led by Redha Malek Allon, Yigal (1918–80) An Israeli statesman and military commander Allon was a commander and one of the founders of the Palmah crack commando...
- 764
- 546
- 1
Photoluminescence and growth mechanism of amorphous silica nanowires by vapor phase transport
... high-magnification TEM image of a catalyst tip, and Figs 2(c) and (d) are the corresponding SAED and high-resolution TEM image of the catalyst, respectively The catalyst is crystallized and surrounded ... silica ‘‘nanobrushes’’ [23] In the vapor transport process, catalyst such as In2O3, Al, Ni, Ga and Sn, and transport gases such as O2, and H2, are often introduced into the reaction In this paper, ... band) and Egreen (green emission band) can be obtained, although the fitting was quite subjective The results are tabulated in Table The red emission band has a relatively constant intensity, and...
- 6
- 429
- 0
synthesis, characterization and growing mechanism of monodisperse fe3o4 microspheres
... indicated the formation of Fe2O3 The reason may be that, on one hand, the amount of ascorbic acid added in the reaction system was relatively lower; on the other hand, a part of ascorbic acid ... with 0.003 mol ascorbic acid, (a) -3 Fe3O4 standard, (a) -4 Fe2O3 after reaction for 24 h with 0.001 mol ascorbic acid, (a) -5 Fe2O3 standard, (b)-1 FeCO3 standard, (b)-2 FeO standard and (b)-3 FeCO3 ... hydrolysis at 70 1C [15,16] This characteristic made the pH of the reaction system change in a narrow range So we selected ascorbic acid as reductant and urea as precipitator In addition, if ascorbic acid...
- 6
- 589
- 0
A Theoretical and Empirical Assessment of the Bank Lending Channel and Loan Market Disequilibrium in Poland doc
... and where Dt denotes the annual growth rate of the demand for bank i loans, St the annual growth rate of the supply of bank loans and Qt the annual growth rate of the observed amount of loans ... The Variations in the Interest Rate Spread as an Indicator of Amplication and Attenuation Effects In order to measure the impact of the bank lending channel we need to dene a standard AD/AS model ... lending channel may amplify as well as attenuate the action of the traditional interest rate channel We found that the change in the interest rate spread between a loan rate and a policy rate is a good...
- 36
- 473
- 0
Báo cáo khoa học: "A Linguistic and Computational Analysis of the German "Third Construction"*" potx
... either an input is read and pushed onto a new stack on top of the stack of stacks, or a fixed number of stacks below and above a designated stack on the stack of stacks is removed and a new symbol ... extraposition cases, I will recast it in terms of a closely related automaton, the Bottom-up EPDA (BEPDA) ~ The BEPDA consists of a finite-state control and of a stack of stacks There are two types of moves: ... will be explained by way of an example, sentence (iv) N1, Na, V2 and Va are read in and placed on new top stacks (moves - 4a) (Popping I/2" would violate the PPI.) Now we unwrap V2* and combine...
- 3
- 354
- 0
Báo cáo khoa học: Flavogenomics – a genomic and structural view of flavin-dependent proteins potx
... metabolism, and chorismate synthase and acetolactate synthase, which are necessary for amino acid biosynthesis Examples of species with a minimal set of enzymes are Pyrococcus abyssi, T maritima, and Saccharomyces ... 2gqf), and a siderophore-interacting protein (family FAD_binding_9 in the clan FAD_Lum_binding) In addition, a novel covalent attachment between a side chain carboxylate group of an aspartate and ... this area has been the subject of numerous review articles that have attempted to fathom and rationalize the capabilities of the flavin cofactor [26–32] The complexity of flavincatalyzed reactions...
- 10
- 460
- 0
Báo cáo khoa học: Flavogenomics – a genomic and structural view of flavin-dependent proteins ppt
... metabolism, and chorismate synthase and acetolactate synthase, which are necessary for amino acid biosynthesis Examples of species with a minimal set of enzymes are Pyrococcus abyssi, T maritima, and Saccharomyces ... 2gqf), and a siderophore-interacting protein (family FAD_binding_9 in the clan FAD_Lum_binding) In addition, a novel covalent attachment between a side chain carboxylate group of an aspartate and ... this area has been the subject of numerous review articles that have attempted to fathom and rationalize the capabilities of the flavin cofactor [26–32] The complexity of flavincatalyzed reactions...
- 10
- 271
- 0
Báo cáo khoa học: Ribonuclease H: molecular diversities, substrate binding domains, and catalytic mechanism of the prokaryotic enzymes ppt
... are Asp10, Glu48, Asp70 and Asp134 for Eco-RNase HI, Asp71, Glu109, Asp132, and Asp192 for Bha-RNase HI, Asp145, Glu186, Asp210 and Asp274 for human RNase H1, and Asp443, Glu478, Asp498 and Asp549 ... Morikawa M, Kanaya S & Morikawa K (2001) Catalytic center of an archaeal type Ribonuclease H as revealed by X-ray crystallographic and mutational analyses Protein Sci 10, 707–714 13 Chapados ... hyperthermophilic archaeon Sulfolobus tokodaii: role of Arg118 and C-terminal anchoring Biochemistry 46, 11494–11503 Katayanagi K, Miyagawa M, Matsushima M, Ishikawa M, Kanaya S, Ikehara M, Matsuzaki T &...
- 12
- 313
- 0
unknown quantity a real and imaginary history of algebra - john derbyshire
... city-state of Babylon, on the middle Euphrates, around the earlier of those dates Hammurabi10 was an Amorite, speaking a dialect of Akkadian He brought all of Mesopotamia under his rule and made Babylon ... religions This was the world of Abraham and Isaac, Jacob and Joseph, Ur and Haran, Sodom and Gomorrah The Western civilization of that time encompassed all of the Fertile Crescent, that nearly continuous ... time, algebra has become the most rarefied and demanding of all mental disciplines, whose objects are abstractions of abstractions of abstractions, yet whose results have a power and beauty that are...
- 391
- 246
- 0
Báo cáo hóa học: " Sargassum fusiforme fraction is a potent and specific inhibitor of HIV-1 fusion and reverse transcriptase" pot
... microglia, and astrocytes by Sargassum fusiforme AIDS Res Ther 2006, 3:15 Hoshino T, Hayashi T, Hayashi K, Hamada J, Lee JB, Sankawa U: An antivirally active sulfated polysaccharide from Sargassum ... NCI-Frederick), and was also quantified for titers of infectious virus by multinuclear activation of a β-galactosidase indicator (MAGI) assay [20] Culture supernatants contained to µg of viral p24 protein ... MTT assay (Fig 1A) Viability of treated cultures remained high and similar to that of mock and 106M ddC treated cells (Fig 1B) Maximal virus replication was determined from infected and untreated...
- 9
- 438
- 0
Báo cáo hóa học: " Closing two doors of viral entry: Intramolecular combination of a coreceptor- and fusion inhibitor of HIV-1" docx
... coefficient calculated on the basis of the amino acid sequence The purity and the proper tetramer formation of mAbs and mAb-FIs were analyzed by SDS-PAGE in the presence and absence of a reducing agent ... that the variable region of the CCR5mAb in BFFI contributes to the antiviral activity Figure Design and biochemical characterization of BFFI Design and biochemical characterization of BFFI A ... NNTTWEAWDRAIAEYAARIEALIRAAQEQQEKNEAALREL B performed BFFI and CCR5mAb had very similar binding affinity to human CCR5, suggesting that addition of the FI did not alter the binding affinity of the...
- 10
- 341
- 0
báo cáo hóa học:" A Process and Outcomes Evaluation of the International AIDS Conference: Who Attends? Who Benefits Most?" docx
... number of past participants who receive IAC announcements and programs, and number of scholarships awarded (eg, significantly more local and international scholarships were awarded at Bangkok compared ... from sub-Saharan Africa (24%) and Asia (32%) Using survey response as a proxy indication of attendance by country is problematic but, at this point, no other data are available Abstract data by country ... cited a behavior change as a result of attending a past IAC Of these, 31% worked in North America, 24% in Europe and the Middle East, and 21% in Africa; 32% were administrators/managers and 29%...
- 11
- 464
- 0
Báo cáo hóa học: " Cytotoxic effects and the mechanism of three types of magnetic nanoparticles on human hepatoma BEL-7402 cells" ppt
... Comparative evaluation of the treatment efficacy of suberoylanilide hydroxamic acid (SAHA) and paclitaxel in ovarian cancer cell lines and primary ovarian cancer cells from patients BMC Cancer 2006, ... the assay kit and the protein concentration was measured using BCA protein assay kit For caspase-3 activity assay, equal amounts of total cell lysates were mixed with a caspase-specific substrate ... Preparation and application of magnetic Fe3O4 nanoparticles for wastewater purification Separation and Purification Technology 2009, 68:312-319 Zhang D, Wei S, Kaila C, Su X, Wu J, Karki AB,...
- 10
- 472
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose