a structural point of view

Báo cáo y học: " Intermolecular masking of the HIV-1 Rev NLS by the cellular protein HIC: Novel insights into the regulation of Rev nuclear impo" doc

Báo cáo y học: " Intermolecular masking of the HIV-1 Rev NLS by the cellular protein HIC: Novel insights into the regulation of Rev nuclear impo" doc

... (5’-GGAUUGUAGGAGUGGAA GATT-3’), MDFIC_5 (5’GGAGUGAGCUGGCUG GAAATT-3’), MDFIC_7 (5’-CAUGAGAUUUAGCAGA CUATT-3’) and luciferase GL2 siRNA (negative control) Quantitative real time RT-PCR analysis of HIC mRNA expression ... transfected with 0.2 μg of pDM128-RRE, 0.02 μg RL-TK and 0.02 μg of HA-Rev or parent plasmid Relative CAT activity was analysed as described above Values are mean ± standard deviation Data are ... μg of HA-Rev and 1, or μg of FLAG-HIC Relative CAT activity is compared with 100% for Rev activity of pDM128-RRE Values are mean ± standard deviation Data are representative of a minimum of three...

Ngày tải lên: 13/08/2014, 01:20

13 283 0
Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt

Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt

... [a3 2P]dCTP and [a3 2P]dTTP (3000 CiÆmmol)1, AmershamBiosciences) DNA polymerase a- primase was added as indicated The incorporation of radioactive dNMP was measured by acid-precipitation of DNA and scintillation ... beforehand with a primase assay on poly (dT) Lanes and 2, control reaction with DNA polymerase a- primase lacking TAg or vice versa; lanes and 4, 0.2 U and 0.4 U of human; lanes and 6, 0.2 U and ... mgÆmL)1 heat treated BSA, and lCi [a- 32P]dCTP and lCi [a- 32P]dTTP (each 3000 CiÆmmol)1, AmershamBiosciences) Recombinant DNA polymerase a- primase was added as indicated After incubation for 90 at 37...

Ngày tải lên: 17/03/2014, 03:20

8 326 0
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

... promoter fragment The sequences of the oligonucleotides used for these experiments are: Oligo I, 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAAGC-3¢; Oligo ... PCR reaction with AtCaM5 primers (forward primer: 5¢-GATGTTGATGGTGATGGTCA-3¢; reverse primer: 5¢-AAACCAGCCATGAATGAAAT-3¢) and with actin primers (forward primer: 5¢-GTTGGGAT GAACCAGAAGGA-3¢; ... primer: 5¢-GAACCA CCGATCCAGACACT-3¢) as a control Reactions with no DNA added served as a negative control The PCR cycling profile was: denaturation at 92 °C for 30 s, annealing at 58 °C for and extension...

Ngày tải lên: 18/03/2014, 01:20

12 365 0
Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx

Báo cáo khoa học: RNA reprogramming of a-mannosidase mRNA sequences in vitro by myxomycete group IC1 and IE ribozymes pptx

... GCCCGATGCCGACAGCA GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTATACCAGCCTCCCTTGGGCA GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGAGTACTCCAAAACTAATCAATAT GGGAATTAATACGACTCACTATAGGNNNNNAAAAGTTATCAGGCATGCACCT ... GGGAATTAATACGACTCACTATAGGNNNNNAAAAGTTATCAGGCATGCACCT GGGAATTAATACGACTCACTATAGGNNNNNGATAGTCAGCATGTACGCTGGC GGGAATTAATACGACTCACTATAGGNNNNTAAAAGCAACTAGAAATAGCGT GGGAATTAATACGACTCACTATAGGNNNNAGGGGACCTTGCAAGTCCCCTA GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGGTATGCGCTTAGCCTTAGAC ... GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCGGTATGCGCTTAGCCTTAGAC GCCCGATGCCGACAGCAGAATGGTTTCACGAACAAGACGTTTGGCAAAACCCTTTGTACCGACCTCCGCCAA CAGCAGAATGGTTTCACG CAGAAGCTCATCCGGCTG AGCATCACGACGCCGTCA...

Ngày tải lên: 23/03/2014, 11:20

12 334 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

... Hagiwara, Y., Hagiwara, H., Ueyama, H & Goldstein, A. L (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulates release of prolactin and growth hormone from rat anterior ... highest grade commercially available Data were expressed as the mean ± standard deviation of at least three independent experiments Statistical significance was assessed by multiple-comparison test ... not of the antioxidants BHA and AsA These results suggested that active oxygens and free radicals did not participate in the TS effect, and that the inhibitory effect of a- T was mediated by a nonantioxidative...

Ngày tải lên: 22/02/2014, 04:20

6 494 0
Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx

Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx

... exchange on eukaryotic initiation factor Nature 296, 93–95 Sudhakar A, Krishnamoorthy T, Jain A, Chatterjee U, Hasnain SE, Kaufman RJ & Ramaiah KV (1999) Serine 48 in initiation factor alpha (eIF2 ... and treated as in (A) Bar, standard error of the mean *1P < 0.01, *2P < 0.001 both functionally and structurally similar to mammalian GCN2 (reviewed in [2]) In yeast, phosphorylation of eIF 2a ... (BioSource, Camarillo, CA, USA), total eIF 2a (Santa Cruz Biotechnology, Santa Cruz, CA, USA), total yeast eIF 2a (gracious gift of T E Dever, National Institutes of Health, Bethesda, MD, USA) or Nck [33],...

Ngày tải lên: 07/03/2014, 05:20

11 376 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

... complexes of inhibitory substrate analogues derived from acarbose and barley a- amylase (AMY2 [16]); and Taka-amylase A (TAA [17]) (A) Stereo view of interactions involving segments of ba loops and ... Y51AMY2 and Y82TAA are at subsite )1 as are H92AMY2 and H122TAA; M52AMY2 (M53AMY1) and W83TAA are at subsite )2; T94AMY2 (C95AMY1) at subsite-5 [38,45]; and Y104AMY2 at subsite-6 (B) Stereo view of ... domain B) from AMY2 (in green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2...

Ngày tải lên: 31/03/2014, 08:20

14 557 0
Báo cáo hóa học: " Supporting QoS in MANET by a Fuzzy Priority Scheduler and Performance Analysis with Multicast Routing Protocols" docx

Báo cáo hóa học: " Supporting QoS in MANET by a Fuzzy Priority Scheduler and Performance Analysis with Multicast Routing Protocols" docx

... Data sessions with randomly selected sources and destinations were simulated Each source transmits data packets at a minimum rate of packets/s and a maximum rate of 10 packets/s The traffic load ... A McAuley, and R Talpade, “AMRoute: Ad hoc Multicast Routing Protocol,” Internet draft, draft-talpade-manet-amroute.00.txt, August 1998 [2] J J Garcia-Luna-Aceves and E L Madruga, “The coreassisted ... International Conference on Advanced Computing & Communication (ADCOM ’04), Ahmedabad, Gujarat, India, December 2004, at IEEE Gujarat section [13] C Gomathy and S Shanmugavel, “Implementation of...

Ngày tải lên: 23/06/2014, 00:20

11 362 0
The Project Gutenberg EBook of Short Cuts in Figures, by A. Frederick Collins pdf

The Project Gutenberg EBook of Short Cuts in Figures, by A. Frederick Collins pdf

... walk a mile than it would to walk a block If such a state of a airs had always existed then primitive man never would have needed to judge that a day’s walk was once again as far as half a day’s ... of nature through which all phenomena are manifested to us arithmetical operations of every kind are based if the calculations are of any practical use.1 The Origin of Counting and Figures.—As ... figures and when you can these without mental effort you are in a fair way to become a rapid calculator and an accurate accountant Quick Single Column Addition.—One of the quickest and most accurate...

Ngày tải lên: 28/06/2014, 19:20

95 383 0
Ultrasonography in In Vitro FertilizationRoger A. PiersonDepartment of Obstetrics, Gynecology pptx

Ultrasonography in In Vitro FertilizationRoger A. PiersonDepartment of Obstetrics, Gynecology pptx

... walls, high numerical pixel value (bright) signals, and highly variable signals from the follicular fluid Evaluation of the acoustic characteristics indicative of viability and atresia is an active ... imaging can help to establish an early and accurate diagnosis (41,42) Computer-Assisted Ultrasonographic Imaging of Follicular Development New work in application of computer-assisted image analysis ... thickness was >10 mm Intra-endometrial flow calculations of the maximal area that showed evidence of motion indicative of vascular flow of < mm2 were associated with a lower pregnancy rate (100)...

Ngày tải lên: 05/08/2014, 16:20

26 178 0
Báo cáo khoa học: "In vitro studies on the modification of low-dose hyper-radiosensitivity in prostate cancer cells by incubation with genistein and estradiol" pot

Báo cáo khoa học: "In vitro studies on the modification of low-dose hyper-radiosensitivity in prostate cancer cells by incubation with genistein and estradiol" pot

... statistics, the software package KaleidaGraph 3.5 (Synergy Software, Reading, USA) was used Means and standard deviations were calculated for each of the data points; statistical comparison of ... multiple-dose administration to men with prostate neoplasia Nutr Cancer 2004, 48:160-170 Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watanabe SI, Itoh N, Shibuya M, Fukami Y: Genistein, a specific ... upregulation of p21WAF1, downregulation of cyclin B, and induction of apoptosis in prostate cancer cells Nutr Cancer 1998, 32:123-131 Onozawa M, Fukuda K, Ohtani M, Akaza H, Sugimura T, Wakabayashi...

Ngày tải lên: 09/08/2014, 09:22

12 368 0
Báo cáo y học: "Discovering and validating unknown phosphosites from p38 and HuR protein kinases in vitro by Phosphoproteomic and Bioinformatic tools" doc

Báo cáo y học: "Discovering and validating unknown phosphosites from p38 and HuR protein kinases in vitro by Phosphoproteomic and Bioinformatic tools" doc

... Innovación de Espa a (MICINN) IL, MD PhD is a recipient of a Grant from “Fundación Leucemia & Linfoma de Espa a) JL and AF are MD PhD and hold a tenured position at Spanish National Hospitals Carlos ... p38 and HuR protein kinases (Prof Ángel R Nebreda and Vanesa Lafarga PhD) Thanks also to the Molecular Modelling Group (CSIC-UAM), and Prof Keith Ashman for allowing use of the LTQ Author details ... Mendieta J, Fuertes MA, Kunchitapatham R, Santa-Mar a I, Moreno FJ, Alonso C, Gago F, Muñoz V, Avila J, Hernández F: Phosphorylation Modulates the Alpha Helical Structure and Polymerization of a Peptide...

Ngày tải lên: 10/08/2014, 09:22

16 265 0
Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot

Báo cáo khoa học:" In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pot

... (Golgi apparatus), small arrow (cell associated vesicle); (E): arrow (plasma membrane), arrow heads (CEVs); (F): arrow (plasma membrane), large arrow heads (EEVs), small arrow head (plasma membrane ... (plasma membrane), arrow heads (CEVs); (C): arrow (plasma membrane), large arrow head (trans-Golgi membrane), small arrow heads (immature viruses); (D): arrow (plasma membrane), large arrow heads ... (CRL-1573) Rat/small intestine; normal Hamster syrian/kidney; normal Human/colon; colorectal adenocarcinoma Rat/liver; hepatoma Human/small intestine; normal Human/duodenum; adenocarcinoma African Green...

Ngày tải lên: 12/08/2014, 04:21

13 377 0
Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps

Báo cáo khoa học: " In vitro host range, multiplication and virion forms of recombinant viruses obtained from co-infection in vitro with a vaccinia-vectored influenza vaccine and a naturally occurring cowpox virus isolate" pps

... (Golgi apparatus), small arrow (cell associated vesicle); (E): arrow (plasma membrane), arrow heads (CEVs); (F): arrow (plasma membrane), large arrow heads (EEVs), small arrow head (plasma membrane ... (plasma membrane), arrow heads (CEVs); (C): arrow (plasma membrane), large arrow head (trans-Golgi membrane), small arrow heads (immature viruses); (D): arrow (plasma membrane), large arrow heads ... (CRL-1573) Rat/small intestine; normal Hamster syrian/kidney; normal Human/colon; colorectal adenocarcinoma Rat/liver; hepatoma Human/small intestine; normal Human/duodenum; adenocarcinoma African Green...

Ngày tải lên: 12/08/2014, 04:21

13 294 0
Báo cáo y học: "Distribution of airway narrowing responses across generations and at branching points, assessed in vitro by anatomical optical coherence tomography" docx

Báo cáo y học: "Distribution of airway narrowing responses across generations and at branching points, assessed in vitro by anatomical optical coherence tomography" docx

... establishing both a spatial and temporal relationship of response The isolated airway preparation was free of parenchymal attachments and had a standardized transmural pressure (pre and afterload) and volume ... in parent and daughter bronchi Graphical presentation and statistical analyses of data were achieved using Graphpad Prism (v4.03, GraphPad Software, CA, USA) and Statistica (99 Edition, StatSoft ... images of a proximal and distal airway before and after the addition of carbachol to the adventitial surface The luminal surface of airways is indicated as well as the location of the optical...

Ngày tải lên: 12/08/2014, 14:20

12 297 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

... (Aaker, 1996) 2.7 Strategic Brand Management Brand management is above all about balancing variety of inputs Balances have to be struck between the external market and internal capabilities of ... managing and maintaining a mix of factors, both tangible and intangible to attract consumer loyalty (Stobart, 1994) BRAND BRAND Organizational Associations Brand Personality PRODUCT Country of ... of Planning and Investment, Vietnam Chamber of Commerce and Industry, from the Internet, and other sources Data analysis: Qualitative analysis was done for secondary data and primary data collected...

Ngày tải lên: 13/04/2013, 10:29

67 977 0
Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx

Tài liệu Báo cáo khoa học: "Exploiting Readymades in Linguistic Creativity: A System Demonstration of the Jigsaw Bard" docx

... that AdjA1 and AdjA2 are mutually reinforcing The combination is indexed on AdjA1+AdjA2 Example: “as dark and sophisticated as a chocolate martini” (3) AdjA NounS where NounS denotes a cultural ... complement of adjectival properties used by Veale and Hao (2007), we harvest all instances of the patterns “as ADJ and * as” and “as * and ADJ as” from Google, noting the combinations that are found and ... readymades” because they allow an artist to remake the act of creation as one of pure insight and inspired recognition rather than one of manual craftsmanship (see Taylor, 2009) In computational...

Ngày tải lên: 20/02/2014, 05:20

6 442 0
Tài liệu In Rare Form A Pictorial History of Baseball Evangelist Billy Sunday pptx

Tài liệu In Rare Form A Pictorial History of Baseball Evangelist Billy Sunday pptx

... YMCA Chapman offered Sunday the position of advance man for his revival circuit As an advance man, Sunday was responsible for traveling to cities and towns days ahead of Chapman, making arrangements ... floral arrangements, a seascape, several rural landscapes, a western mountain landscape, and her own interpretation of the well-known painting Pharaoh’s Horses.9 The rural landscapes are particularly ... major league baseball, Kenesaw Mountain Landis (who in 1935 served as a pallbearer at Sunday’s funeral), A B “Happy” Chandler, and Ford Frick, as well as Hall of Fame pitcher Walter Johnson, adorned...

Ngày tải lên: 21/02/2014, 06:20

169 398 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

... purification of MAO A The gene encoding human liver MAO A was amplified from a cDNA clone obtained from MRC Geneservices (Cambridge, UK) using the primers 5¢-GTCTTCGAA ACCATGGAGAATCAAGAGAAGGCGAGTATCGCGG ... in MAO A R V Dunn et al Fig S5 Substrate dependence of the reductive halfreaction of MAO A- catalysed oxidation of PEA at pH 8.5 and 20 °C This material is available as part of the online article ... dependence of the reductive half-reaction of MAO A- catalysed oxidation of benzylamine at 20 °C Fig S3 Reaction transient for MAO A- catalysed oxidation of 0.5 mm PEA at pH 9.0 and 20 °C Fig S4 Reaction...

Ngày tải lên: 07/03/2014, 06:20

9 327 0

Bạn có muốn tìm thêm với từ khóa:

w