a state of the art review

... those of iron metal, indicating metallic nature and a localized 3d band (Yang et al., 2009) As is anticipated, the variation in the full width at half maximum (FWHM) of the Fe L3 peak in the XAS and ... increase in the 4p holes and a decrease in the 5p holes at y=0.5 The tetragonal phase of FeSe has a planar sub-lattice layered structure with Se ions at the tips of the pyramid chain and an Fe plane ... broad peak is a part of the Fe 4sp band The e1 feature appears at an energy between those of the Fe metal and FeO and, therefore, originates from a different interaction, as discussed later Based...

Ngày tải lên: 29/06/2014, 13:20

... condensation of a molecule of b-alanine with a molecule of pantoate in an ATP-dependent manner to form pantothenate [1,2] Pantothenate itself is an important cofactor that is essential for CoA biosynthesis, ... binding of pantoate to the ATP-binding site also reveals the origin of the negative cooperativity with b-alanine [9] at high pantoate concentrations The model of A thaliana PS (Fig S5) shows that there ... (magenta) In nPS, the pantoate molecule takes the position of the adenine ring of ATP The carbon and oxygen atoms of pantoate are shown in yellow and red, respectively The carbon and oxygen atoms...

Ngày tải lên: 16/02/2014, 09:20

... suppression of transamination reactions that would otherwise obscure the labelling pattern Thus, an early attempt of combinatorial labelling in vivo had to exclude glutamine, glutamate, asparagine and aspartate ... interpretation of nuclear magnetic resonance spectra of proteins Q Rev Biophys 23, 1–38 Yamazaki T, Yoshida M, Kanaya S, Nakamura H & Nagayama K (1991) Assignments of backbone 1H, 13C, and 15N resonances ... 15N-labelled amino acids used in the cell-free preparation of the five different samples The last column displays the average amino acid abundance in proteins according to the NCBI database 19 amino acid...

Ngày tải lên: 07/03/2014, 12:20

... human articular cartilage CS, represents over 50% of the chain caps for a normal adult, but only  30% at the termini of CS chains from osteoarthritic cartilage [18,19] Whereas the CS chain caps ... GalNAc (E) Hexasaccharides Although data from disaccharides, trisaccharides and tetrasaccharides are valuable for the detailed structural characterizations of unknown segments derived from the ... Santos EA, Dietrich CP & Nader HB (1994) Appearance and fate of a beta- 13 14 15 16 17 18 19 20 21 22 23 galactanase, alpha, beta-galactosidases, heparan sulfate and chondroitin sulfate degrading...

Ngày tải lên: 16/03/2014, 14:20

... Services and Research Administration of the Department Administration of the Department of Veteran Aairs (to C H W.) We thank A Werner and F Wendling for expert help with the preparation of the manuscript ... spectrum of TrxR in the reduced state, as compared with that of the oxidized state, indicates a considerable congurational change of the pyrophosphate group of FAD in TrxR, associated with a conformational ... separated in the latter enzyme, whereas overlap occurs in the other preparations (Fig 4A and Fig 7A) The state of hybridization of the N(10) atom is also reected by the chemical shift of the...

Ngày tải lên: 16/03/2014, 16:20

... Tanemura K, Murayama O, Akagi T, Murayama M, Sato S, Sun X, Tanaka N & Takashima A (2001) New insights on how metals disrupt amyloid beta-aggregation and their effects on amyloid-beta cytotoxicity ... terms of a first-order binding process An apparent dissociation constant appKd* can be calculated; the star indicates that the dissociation A Y10 Y10 B Fig 1H–13C HSQC spectra of the aromatic regions ... exhibit a total loss of H6 and H14 resonances, and a weak H13 resonance remains at the same chemical shift The tyrosine aromatic crosspeaks are unaffected upon zinc addition B A H13 H6 FEBS Journal...

Ngày tải lên: 23/03/2014, 10:20

... in the phase I Intracellular ATP and ADP concentrations in phase I were estimated based on 31P NMR data The data shown are the mean ± SD Fig Changes in cellular ATP, ADP and ATP/ADP of the XMP ... intracellular metabolites, NADP was used as a concentration standard in the NMR Partially relaxed 8,9 MDP was used to estimate metabolite concentrations ND, not determined Values are the mean ... the production phase (A) Cellular ATP (s) and ADP (d) concentrations are shown (B) Cellular NADP (j) is shown To quantify the intracellular metabolites, MDP was used as a concentration standard...

Ngày tải lên: 23/03/2014, 17:22

... measured the rate constants for the binding of HPO, the oxidized form of HP These measured rate constants are reliable and accurate, because of (a) the high quality of the stopped-flow data as ... was rather rapid in the presence of SaDHNA The apparent Km for GA obtained by varying GA at a fixed HP Fig HPLC analysis of the reverse reaction catalyzed by SaDHNA The initial reaction mixture ... dihydroneopterin aldolase Y Wang et al Fig Summary of the kinetic constants for the SaDHNA-catalyzed (top panel) and EcDHNA-catalyzed (lower panel) reactions Sa and Ec represent SaDHNA and EcDHNA, respectively...

Ngày tải lên: 19/02/2014, 00:20

... previously, Arg78 is of particular interest as it is the target of various post-translational modifications that might lead to demyelination Therefore, parti- cular attention was paid to the dynamic behaviour ... chain of Arg78 is almost always less than A from a negatively charged group, mainly Asp81 and Glu82, but also the COO– terminal of Val85 This is definitely not the case for the antagonist, as Arg78 ... the case of the agonist, which makes it somewhat more accessible than the antagonist, as suggested by the solvent-accessible surface area These data clearly demonstrate the structural importance...

Ngày tải lên: 07/03/2014, 16:20

... melibiose and a- Me-Gal, as anomers of lactose and b-Me-Gal, was in the intermediate exchange regime Thus, the configuration at the hemiacetal carbon of galactose may affect the dissociation constants ... exchange, of which the Kd should have a medium value between that in the slow exchange regime and that in the fast exchange regime, titration data indicated that the interaction with sugars had a Kd of ... at pH 6.1 and 298K in the sugar-free state Cross-peaks are labeled based on an analysis of through-bond connectivities The side chains of NH2 resonances of asparagines and glutamines are connected...

Ngày tải lên: 23/03/2014, 04:21

... native and denatured states in the entire range of urea concentrations, there is a pronounced lag between the disappearing population of the native species and the appearing population of the denatured ... than the other parts of the protein, whereas in the transition from the native and intermediate states to the denatured state, the stabilities of different residues are similar except for the ... which has lower stability and is more readily denatured at high urea concentrations Analysis of the midpoints of the transitions shows that the unfolding of the native state and formation of the...

Ngày tải lên: 14/09/2015, 14:04

... data in the pooled analysis, included durations of mechanical ventilation, ICU stay, and hospitalization Duration of mechanical ventilation was defined as stop date - maximum (start date or randomization ... for its services Authors' contributions MK had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis MK contributed ... design, analysis of results, interpretation of findings, and drafting of the paper Independent statistical analysis The accuracy of the data analysis was independently verified by William Shannon,...

Ngày tải lên: 25/10/2012, 10:02

... is also notable that the detection of a frontal N2 is associated only with instances of a NOGO response Thus, the P300 appears to be inhibited by the appearance of the N2b in tasks of motor activity ... including the basal ganglia, as well as clinically-evident dysfunction of the superficial cerebral cortex, associated in particular Int J Med Sci 2005 with spreading and advanced disease For instance, ... in auditory, visual, and somatosensory domains may fall under the integrated purview of the MMN, N2b, and P300 phenomena Future applications of ERP analysis as a psychological diagnostic and...

Ngày tải lên: 02/11/2012, 11:08

... risk management has increased Ericsson Software Technology The company claims that the initiative was "more valuable" than a database and measurement-approach Ơ Yes Ư Australian Telecom Company ... eight companies did a reorganisation as a part of the knowledge management initiative, to have a separate part of the organisation responsible for this kind of activities The type of knowledge ... Disasters [7] and Software Runaways [8] After listing all these problems that exist in software, you may ask: are all software systems that bad? That is not so, there are a lot of software projects...

Ngày tải lên: 16/01/2014, 16:33

... brown layer cease to grow These scales are farther apart toward the margin of the cap, because this portion of the cap always expands more than the center, in all mushrooms The =gills= are at first ... is called the _trama_ The trama in the case of this plant is made up of threads with rather long cells Toward the outside of the trama the cells branch into short cells, which make a thin layer ... irregularly On the surface are silky or tomentose threads not much elevated from the surface, and as the plant ages these are drawn into triangular scales which are easily washed apart by the rains The...

Ngày tải lên: 13/02/2014, 12:20

... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phosphoribosyltransferases is examined using saturation mutagenesis, functional analysis, and X-ray ... structure, a water molecule is found at approximately the same distance from N7 of the guanine base as is the oxygen of the aspartic acid side chain in the HPRT complex (Fig 2B) It is possible that this ... phosphoribosyltransferase activity [10] The structural characterization of numerous complexes of the human HPRT and several bacterial and protozoan HPRTs have been undertaken [13–17] The structure of human HPRT can...

Ngày tải lên: 15/02/2014, 01:20

... results) The enzyme activity of the recombinant LDH was assayed at 70 °C by monitoring the lactate-dependent NADH oxidation as the decrease in A3 40 The standard assay mixture contained mm lactate, ... 8.0) The assay mixture without NADH and acetyl-CoA was incubated at 70 °C under an argon atmosphere The reaction was started by adding the NADH, acetyl-CoA and enzyme solutions to the mixture, and ... Journal compilation ª 2009 FEBS 509 Pyruvate synthesis by pyruvate oxidoreductase T Ikeda et al 34 Ozawa Y, Nakamura T, Kamata N, Yasujima D, Urushiyama A, Yamakura F, Ohmori D & Imai T (2005) Thermococcus...

Ngày tải lên: 16/02/2014, 09:20

... metropolitan areas complained of narrowness of their houses in the 1960 s At the time, airtight houses started to be built in urban area, and air pollution due to a lack of fresh air because of the ... concentration of radon and its metabolites is increased in concrete single-family homes.129) Nano-particles and Nano-materials The health effects of nano-particles and nano-materials have been reviewed.117–121) ... (in Japanese) IPCS (1989) Environmental Health Criteria 89 Formaldehyde, World Health Organization, Geneva Takeda, M., Saijo, Y., Yuasa, M., Kanazawa, A. , Araki, A and Kishi, R (2009) Relationship...

Ngày tải lên: 17/02/2014, 22:20

... 5¢-CAGCGTGACATAACTGTTAAA GGGCATGGCCCA-3¢ R105H-fwd: 5¢-GCTAAAAATAA R105HTGGAGCACTCCATTTTTAGCGCTCGC-3¢ rev: 5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTAT TTTTAGC-3¢ R105K-fwd: 5¢-GCTAAAAATAATGGAG AAATCCATTTTTAGCGCTCGC-3¢ ... substrates was unchanged, whereas catalytic activity was altered because the kcat value had decreased dramatically The structural study showed that the backbone conformation of the enzyme was unchanged ... E52Q-rev: 5¢-GCGCCACTTCTCGACGGGCTG GGTCAGCAGGC-3¢ Y70W-fwd: 5¢-CTGCTGGAGCT GATGTGGAAAGATCCCAAGAAG-3¢ Y70W-rev: 5¢-CTT CTTGGGATCTTTCCACATCAGCTCCAGCAG-3¢ Q81Nfwd: 5¢-TGGGCCATGCCCTTTAACAGTTATGTCACG CTG-3¢...

Ngày tải lên: 19/02/2014, 02:20

... salmonicida and V cholerae Table List of PCR primers Restriction sites are underlined No Sequence GCTTTTAAAGTTGACTTCAAAG CTTTGAAGTCAACTTTAAAAGC CTACCATGGCACCTCCTTCTTCTTTCTCAA GCTGTCGACTTATTTAGTGCATGCTTTATAAACAA ... possible that the enzymes also have adapted strategies to remove Na+ around the phosphates of DNA before catalysis can take place It seems clear that the saltadapted and cold-adapted properties of VsEndA ... plotted and the mean values are drawn Table VsEndA possesses a higher kcat than VcEndA at all temperatures, and the Km values of VcEndA are slightly lower than for VsEndA at all temperatures Table Kinetic...

Ngày tải lên: 19/02/2014, 05:20