a standards primer for clinical engineers

... this area gives a permissible load based on bearing capacity as 5.3.3 Bearing Capacity The fashion in which the connected material reacts against a bolt that is loaded in shear was described in Article ... is a spiral, the reduced area is greater than an area taken through the thread root A notional area, the tensile stress area ( A st ), that will accommodate this was introduced in Chapter as ... usual way, that takes the same form as the AISC modifier U This is— Ae UA n (5.8) where A e effective net area, to be used in calculating the ultimate load A n net area calculated in the usual...

Ngày tải lên: 24/10/2014, 17:04

... ANTERIOR SPINAL paraplegia/quadriplegia, ante rior cord syndrome CLASSIFICATION SYSTEMS  STANFORD A ¼ any ascending aorta involvement, B ¼ all others CLINICAL FEATURES RATIONAL CLINICAL EXAMINATION ... GOODPASTURE DISEASE  PATHOPHYSIOLOGY antibasement membrane antibodies ! attack pulmonary and renal base ment membrane  CLINICAL FEATURES hemoptysis and hematuria, with respiratory and renal failure ... PATHOPHYSIOLOGY ANATOMY layers of aorta include intima, media, and adventitia Majority of tears found in ascending aorta right lateral wall where the greatest shear force upon the artery wall is produced AORTIC...

Ngày tải lên: 06/03/2014, 11:20

... (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature using a Waters Altantis column (100 × 2.1 mm i.d.) packed with a μm ODS stationary ... detected (Figure 3A) and the chromatographic peaks of 2-PMPA and internal standard (Figure 3B) allowed for quantitation of material in the Rojas et al Journal of Translational Medicine 2011, ... activity assay provides a simple and direct measurement of GCP activity from tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate;...

Ngày tải lên: 18/06/2014, 19:20

... Darmstadt, Germany) in an ABI 7300 analyzer Primers used for determining mRNA expression levels were as follows: CD24 fwd 5’-TGC CTC GAC ACA CAT AAA CC3’, CD24 rev 5’-GTG ACC ATG CGA ACA AAA ... AAA GA-3’; GAPDH fwd 5’-ACA CCC ACT CCT CCA CCT TT-3’, GAPDH rev 5’-TGC TGT AGC CAA ATT CGT TG-3’ To compare and quantify different measurements a cellular cDNA was used as standard and the amount ... esRNA was analyzed by PCR (C) Total RNA was isolated from amniotic fluid and urine exosomes and analyzed via an Agilent Bioanalyzer The results show that exosomes contain variable amounts of 18 and...

Ngày tải lên: 18/06/2014, 19:20

... (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature using a Waters Altantis column (100 × 2.1 mm i.d.) packed with a μm ODS stationary ... detected (Figure 3A) and the chromatographic peaks of 2-PMPA and internal standard (Figure 3B) allowed for quantitation of material in the Rojas et al Journal of Translational Medicine 2011, ... activity assay provides a simple and direct measurement of GCP activity from tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate;...

Ngày tải lên: 20/06/2014, 03:20

... Darmstadt, Germany) in an ABI 7300 analyzer Primers used for determining mRNA expression levels were as follows: CD24 fwd 5’-TGC CTC GAC ACA CAT AAA CC3’, CD24 rev 5’-GTG ACC ATG CGA ACA AAA ... AAA GA-3’; GAPDH fwd 5’-ACA CCC ACT CCT CCA CCT TT-3’, GAPDH rev 5’-TGC TGT AGC CAA ATT CGT TG-3’ To compare and quantify different measurements a cellular cDNA was used as standard and the amount ... esRNA was analyzed by PCR (C) Total RNA was isolated from amniotic fluid and urine exosomes and analyzed via an Agilent Bioanalyzer The results show that exosomes contain variable amounts of 18 and...

Ngày tải lên: 20/06/2014, 03:20

... bands are called durain; satiny bands are clarain; charcoal bands are fusain; and black, glassy bands are vitrain Bright coals have lots of vitrain and clarain; dull coals are rich in durain bands ... The slag is usually found to be non-hazardous and can be used as an admix for road construction material or abrasive material for sand blasting It can also be disposed of as non-hazardous waste ... along joints called cleats Vitrain and clarain are brittle and break easily "Block coals" are dull coals that break into large blocks because they have fewer vitrain and clarain bands, but have...

Ngày tải lên: 02/04/2014, 15:12

... ways to improve the load capability of a ball screw? A: There are no magic ways to increase the load capacity of a standard ball screw A load carrying grease can help extend the life of an assembly ... Contamination of any kind will increase wear and reduce life regardless of lubricant used Q: Are there seals to retain the grease in the ball screw housing? A: Wipers are available as standard ... overall load rating will not change The load capacity of a ball screw is calculated based on the life of the ball bearing and the materials of construction Better materials, larger components, larger...

Ngày tải lên: 13/12/2013, 01:16

... This has concentrated financial activity and decision-making in a few economic organizations and also integrated areas of financial activity earlier separated from one another to ensure transparency ... as real estate and stock markets, ability to increase exposure to particular sectors and individual clients and increased regulatory forbearance all lead to increased instances of financial failure ... crises, but to the argument that it has a clear bias towards deflationary macroeconomic policies and forces the state to adopt a deflationary stance to appease financial interests (Patnaik, 2003) To...

Ngày tải lên: 23/12/2013, 13:15

... education and technical training The Novamill is controlled via a standard keyboard or Desk-Top Tutor connected to a PC An optional station Automatic Tool Changer (ATC) is also available (Denford ... toolmakers, machinists and students with a broad range of material, from the very basic to the more advanced As always, it continues to provide industry fundamentals and standards while it leaps ahead ... have as many CDCs available as there are tool pockets in the tool storage matrix The advantage of the CDC feature is that it: allows the use of cutters that have been sharpened to a smaller diameter...

Ngày tải lên: 25/12/2013, 05:16

... tích cực vay nợ (kết nghịch) => rủi ro tín dụng cao => người cho vay phản ứng nghịch khơng cho vay, kể người có rủi ro thấp thấp Rủi ro đạo đức (Moral Hazard): Xảy sau giao dịch Người vay có động ... quản trò tài : g q ò Vay nợ khẳng đònh mức độ tín nhiệm/ giá trò doanh nghiệp Tuy vậy, doanh nghiệp vay nợ, rủi ro vơ nợ ( h ù san) cang cao C ù chi phí vơ nợ: ỡ (pha û ) ø Cac hi hí ỡ Chi phí trực ... Slide #14-17 Corporate bond Commercial paper C i l Nguồn tài trợ Mỹ 1970-1985 Government loans loans b f i l by foreigners Trade debt Copyright © 2000 Addison Wesley Longman Slide #14-18 Nguồn...

Ngày tải lên: 20/01/2014, 19:20

... ECAPR 7/18/06 6:33 PM Page i Clinical Anatomy ECAPR 7/18/06 6:33 PM Page ii To my wife and late parents ECAPR 7/18/06 6:33 PM Page iii Clinical Anatomy A revision and applied anatomy for clinical ... posteroanterior and lateral radiographs as a dark area passing downwards, backwards and slightly to the right In the elderly, calcification of the tracheal rings may be a source of radiological confusion ... anterior primary rami of the thoracic nerves, each of which gives off a collateral muscular branch and lateral and anterior cutaneous branches for the innervation of the thoracic and abdominal walls...

Ngày tải lên: 17/02/2014, 19:20

Ngày tải lên: 27/02/2014, 07:20

... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, ... Similarly to bank loans, credit standards are endogenous to GDP growth Since credit availability depends on lenders’ standards, if, for instance, credit standards tighten, this can generate a decrease...

Ngày tải lên: 15/03/2014, 10:20

... Canadian Guidelines on Sexual Health Education  Sexual health is a major, positive part of personal health and healthy living. Sexual health  education should be available to all Canadians as an important component of health promotion  ... Resources for Teachers 7  4.  Canadian Guidelines for Sexual Health Education  The Public Health Agency of Canada has published guidelines on sexual health education for Canadians of all ages. This guide was prepared with advice from experts, citizens and teachers.  ... The teachers section on the web site has been developed by a team of educators from across  Canada and is co­chaired by the staff of the Canadian Association for School Health and the Sex  Information and Education Council of Canada.  The teachers’ section of...

Ngày tải lên: 22/03/2014, 15:20

... (Goldstein et al., 2007; Farkas and Szarvas, 2007; Crammer et al., 2007; Aronson et al., 2007; Patrick et al., 2007) Aronson et al (2007) used a variant of National Library of Medicine Medical Text ... decision equally important and is therefore dominant by the performance on frequent codes in data Moreover, a hierarchical micro-averaged (hierarchical) F1 is also introduced by adding all ancestors ... negated terms were removed Conclusion and Future Work Compared to a flat classification approach, a hierarchical framework is able to exploit relationships among categories to be assigned and easily...

Ngày tải lên: 31/03/2014, 00:20

... restrict how much information a digital signal can contain This chapter is about information management: understanding what information you need to retain, and what information you can afford to lose ... pdf has virtually become a Gaussian This procedure can be used to create a normally distributed noise signal with an arbitrary mean and standard deviation For each sample in the signal: (1) add ... is a classic example of things that the human brain does well, but digital computers poorly Digital computers can store and recall vast amounts of data, perform mathematical calculations at blazing...

Ngày tải lên: 18/04/2014, 12:32

... TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG Location* Length GC % Tm(°C) Amplicon ... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ... amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC...

Ngày tải lên: 18/06/2014, 18:20

... Ministry of Health, Republic of Uganda; 2003 Kamya MR, Mayanja-Kizza H, Kambugu A, Bakeera-Kitaka S, Semitala F, Mwebaze-Songa P, Castelnuovo B, Schaefer P, Spacek LA, Gasasira AF, Katabira E, Colebunders ... Diseases Institute (IDI) in Kampala, Uganda, is a centre of excellence for HIV clinical care in the country, and maintains a large observational clinic database and a nested research cohort database ... Kumarasamy N, Ditangco R, Kamarulzaman A, Lee CK, Li PC, Paton NI, Phanuphak P, Pujari S, Vibhagool A, Wong WW, Zhang F, Chuah J, Frost KR, Cooper DA, Law MG: The TREAT Asia HIV Observational Database...

Ngày tải lên: 20/06/2014, 08:20

... general survey of the anal area, noting fissures, excoriations, lacerations, and hemorrhoids A digital rectal exam followed by anoscopy may reveal the object or signs of trauma proximal to the anal ... accurate information about the foreign body Information should be sought as to the objects approximate size, shape, material, length of time since insertion, and any attempts at removal For examination, ... object and the balloon inflated If a three-way Foley is unavailable, a small-diameter endotracheal tube can be used In either case, the catheter with the balloon inflated or the endotracheal tube...

Ngày tải lên: 20/06/2014, 21:20