a stable model linked to local markets

... Arthritis Research & Therapy Vol 10 No Vonkeman et al with NSAIDs) with the appropriate pharmacoeconomic information Materials and methods The pharmacoeconomic evaluation was linked to a 26-month ... the observational period Data for these cases was retrieved from questionnaires and hospital administrative records The typical case is an older patient, mean age at diagnosis 70.4 years (SD 16.7; ... Hospital service utilisation was determined using standard hospital administrative records and included the number of intensive care and standard care in-patient days, emergency department care, ambulance...

Ngày tải lên: 09/08/2014, 01:22

... Arthritis Research & Therapy Vol 10 No Vonkeman et al with NSAIDs) with the appropriate pharmacoeconomic information Materials and methods The pharmacoeconomic evaluation was linked to a 26-month ... the observational period Data for these cases was retrieved from questionnaires and hospital administrative records The typical case is an older patient, mean age at diagnosis 70.4 years (SD 16.7; ... Hospital service utilisation was determined using standard hospital administrative records and included the number of intensive care and standard care in-patient days, emergency department care, ambulance...

Ngày tải lên: 09/08/2014, 13:22

... Kong Singapore Ireland Norway Germany Japan Netherlands Mauritius Italy Canada Korea Sweden Denmark Austria Macao Belgium Spain Cyprus Switzerland Kazakhstan Malaysia Australia Thailand Finland Egypt ... Costa Rica, Panama, Uruguay, Venezuela, Bahamas, Aruba, Bahrain, Cyprus, Lebanon, Egypt, Arab Rep., Hong Kong, Indonesia, Korea, Macao, Malaysia, Pakistan, Philippines, Singapore, Thailand, Mauritius, ... this thesis also aims to provide an explanation to Asean+3 refers to Asean, Japan, Korea and China Unfortunately, China is a not a participant of the CPIS survey, the main data source that is used...

Ngày tải lên: 04/10/2015, 07:39

... Wang, personal communication) Miao et al (2009) have been developed two dominant SCAR markers, TSCARAAT/CGA and TSCARAAG/CAT associated with bacterial wilt resistance using different materials ... using BSA and RAPD methods have been reported (Du et al., 2011; Iglesias-Andreu et al., 2010; Khampila et al., 2008; Makandar and Prabhu, 2009; Parihar et al., 2010; Shobha and Thimmappaiah, 2011; ... the pathogen and environmental factors such as high temperature (Jaunet and Wang, 1999) and specific isolates (Hanson et al., 1996; Truong et al., 2008, Wang et al., 2013) The tomato line Hawaii...

Ngày tải lên: 27/09/2016, 01:35

Ngày tải lên: 26/01/2014, 07:20

... the sample to high intensity light beam, was restricted to < 3% of the initial intensity and was always taken into consideration in the analysis of the titration data Akhavan S, Mannucci PM, Lak ... Haemost 84, 989–997 De Cristofaro R, Akhavan S, Altomare C, Carotti A, Peyvandi F & Mannucci PM (2004) A natural prothrombin mutant reveals an unexpected influence of A- chain structure on the activity ... k1), as seen experimentally In analogy with the values calculated in enzymatic experiments, an increase of % 0.5 pK units of the His57 in DK9 mutant was also calculated analyzing the NAPAP data...

Ngày tải lên: 07/03/2014, 12:20

... characteristics of a language automatically and is able to produce an acoustic model that outperforms a language-mismatched acoustic model trained with high supervision Table shows that our model ... framework Acknowledgements The authors would like to thank Hung-an Chang and Ekapol Chuangsuwanich for training the English and Thai acoustic models Thanks to Matthew Johnson, Ramesh Sridharan, ... corpus Andrew Gelman, John B Carlin, Hal S Stern, and Donald B Rubin 2004 Bayesian Data Analysis Texts in Statistical Science Chapman & Hall/CRC, second edition James Glass 2003 A probabilistic framework...

Ngày tải lên: 07/03/2014, 18:20

... A state in this space is a partial alignment A transition is defined as the addition of a single link to the current state Any link which would create a state that does not violate any constraint ... parallel texts In Proceedings of the 4th Speech and Natural Language Workshop, pages 152–157 DARPA, Morgan Kaufmann Rebecca Hwa, Philip Resnik, Amy Weinberg, and Okan Kolak 2002 Evaluating translational ... algorithm that can handle many -to- one alignments This would involve training from an initial alignment that allows for many -to- one links, such as one of the IBM models Features that are related to multiple...

Ngày tải lên: 17/03/2014, 06:20

... from attacking dead targets (which also may lead to an overestimation of the damage to targeted systems) This too was not a limitation to the IOF Allocator but rather of the incoming data Finally, ... preprocessor again to create the input to the math solver The ability to make quick changes to the scenario also enables exploratory analyses and quick-reaction analyses Table B.1 Run-time Analysis ... a positive target Tanks are assigned a value of 10, and collateral targets are assigned a value equal to the negative of one tank (–10) There is an overkill factor of two in this example, meaning...

Ngày tải lên: 23/03/2014, 02:20

... converted a unique SspI site on the vector to an EcoRV site The mutagenesis oligonucleotides were 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA G-3¢ (Lys70 to Ala), and 5¢-GGTAACTGTATATGAA ... mutagenesis kit (Clontech, Inc., Palo Alto, CA, USA) using the method of Deng and Nicloff [19], as directed by the manufacturer The selection oligonucleotide, 5¢-AAATGCTTCAATGATAT CGAAAAAGGAAG-3¢, ... DNA which had previously been subcloned into the plasmid vector pUC119 [16] The forward primer, 5¢-GCTACCATATGAAAACAGCTTGGTAGGT-3¢, encompassed the ATG start codon of cyp and contained a 5¢ extension...

Ngày tải lên: 23/03/2014, 17:21

... could model the probability P (w|tn ) One way is to assume a generative model whereby a word w and a surface pronunciation tn are related via an underlying canonical pronunciation sm of w and a stochastic ... reached at or before the last frame Associated with each node is a probability function that maps the node’s parent values to the values the node can take We will refer to that function as a ... that other important problems such as machine translation can benefit from a Graphical Models perspective Machine translation presents a fresh set of challenges because of the large combinatorial...

Ngày tải lên: 23/03/2014, 19:20

... user’s last dialogue act, which was found to produce a 52% increase in average reward Williams et al (2003) used Supervised Learning to select good state and action features as an initial policy to ... shows that as we add more data, the values for each state converge So in general, we can say that the values for our Baseline case are fairly stable Next, we add Student Moves, Frustration, Concept ... discount factor ranges between and and discounts the value of past states The policy iteration algorithm (Sutton and Barto, 1998) iteratively updates the value of each state V(s) based on the values...

Ngày tải lên: 24/03/2014, 03:20

... Explanation (though not as detailed as Current Competitors) on who they are or maybe and why they are seen as potential competitors o o o o o o • Additional • • Extraneous Variables o Discuss factors ... used Products and Services that appeal to the target market o In general terms (not particular brands) what is currently appealing to this market o If there are no current providers, what types of ... releases, financial statements) Financial and Market Share Analysis – includes sections on corporate performance, trends, market share for product Marketing – includes sections on products and...

Ngày tải lên: 28/03/2014, 19:20

... Antibody (raised in rabbit) against FAEES was used to react with pure FAEES protein Lane shows no band (control lane) Rat albumin was used as control protein Lane shows a clear band at 60 kDa activity ... reverse 5¢-CATGTAGGCCATGAGGTC CACCAC-3¢); APN (forward 5¢-ATGGGCTATGGGTA GTTGCAGTCA-3¢, reverse 5¢-TAGCTTCATGCTTTGG GTCCTCCA-3¢ Laser photocoagulation Control (n ¼ 10), pair-fed (n ¼ 10) and alcohol-fed ... down, on a glass slide in Aqua mount Flat mounts were stained with a monoclonal antibody against elastin (Sigma) and a CY3-conjugated secondary antibody (Sigma) and examined using a confocal microscope...

Ngày tải lên: 30/03/2014, 11:20

... break with the classical liberal tradition Are we about to repeat the trauma of the Great Depression? We have much better analytical and policy tools at our disposal today than were available ... unregulated spaces in developed countries and the dynamic markets of East Asia and beyond Gradually, the dead hand of the state gives way, and the global financial markets regain their freedom again ... merchant’s bank is paid by the bank issuing the credit card through card association channels and pays a net amount to the merchant The card association essentially acts as a vast global clearinghouse...

Ngày tải lên: 29/05/2014, 23:41

... retail banking, as a core strategy to harness collaborative commerce, increase business geographic area, and sustain competitive advantage, have an opportunity to reformat the organizational ... competencies, and function as a ubiquitous organization, while retaining a stable customer interface Participants in the study had reasonable awareness of the organization‘s operations, and participants ... studies to date indicated a need for industry–academia collaboration for a better understanding of the emerging paradigms applicable to the retail financial services area There is a six-part information...

Ngày tải lên: 01/06/2014, 13:57

... identical to an L5 DNA region harboring L5 gp64 gene and an upstream operator (5'GGTGGATGTCAAG) [10] In this communication, we have designated the L1 DNA fragments carrying operators 5'GGTGGATGTCAAG ... studies in fact revealed that affinity of CI to a 21 bp DNA fragment (carrying 5'GGTGGATGTCAAG) is about 2.57 fold higher than that to another 21 bp DNA fragment harboring 5'GGTGGCTGTCAAG (data not ... (His-CI), a vector pSAU1180 was constructed by cloning an L1 DNA [12,17] (amplified with primers, LCP2: 5'AAGCTTCCTTTCGTTGCGCGGC and LCP3: 5'GAATTCATGAGCGGCAAAATC) to pET2 8a (Novagen, USA) This...

Ngày tải lên: 18/06/2014, 18:20

... method and an automated staining device (Autostainer plus, DakoCytomation, Hamburg, Germany) We used the standard protocol recommended for the staining kit (Dako Real, Cat K5005, DakoCytomation) ... intraoral inflammation [1,16] Galectin-3 was shown to specifically inhibit LPS-associated cytokine activation, a characteristic of intraoral gram negative bacteria [16] The potential role of Galectin-3 ... Germany) and then dewaxed in graded alcohol in preparation for immunohistochemical staining Immunohistochemical staining was performed with the alkaline phosphatase-anti-alkaline phosphatase...

Ngày tải lên: 18/06/2014, 19:20

... identical to an L5 DNA region harboring L5 gp64 gene and an upstream operator (5'GGTGGATGTCAAG) [10] In this communication, we have designated the L1 DNA fragments carrying operators 5'GGTGGATGTCAAG ... studies in fact revealed that affinity of CI to a 21 bp DNA fragment (carrying 5'GGTGGATGTCAAG) is about 2.57 fold higher than that to another 21 bp DNA fragment harboring 5'GGTGGCTGTCAAG (data not ... (His-CI), a vector pSAU1180 was constructed by cloning an L1 DNA [12,17] (amplified with primers, LCP2: 5'AAGCTTCCTTTCGTTGCGCGGC and LCP3: 5'GAATTCATGAGCGGCAAAATC) to pET2 8a (Novagen, USA) This...

Ngày tải lên: 20/06/2014, 01:20

... this article as: Chu et al.: AIDS-associated Kaposi’s sarcoma is linked to advanced disease and high mortality in a primary care HIV programme in South Africa Journal of the International AIDS ... access to both cART and chemotherapy for patients with AIDS-associated KS KS is the most common HIVrelated malignancy and an important contributor to AIDS-related mortality Early diagnosis and improved ... at their last contact date Transfers were censored at the transfer date The national death registry and local hospital records were used to confirm vital status Cox proportional hazard models were...

Ngày tải lên: 20/06/2014, 08:20