a small piece from a spiritual journey

Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx

... 8784–8792 Kawana Y, Kawana K, Yoshikawa H, Taketani Y, Yoshiike K & Kanda T (2001) Human papillomavirus type 16 minor capsid protein L2 N-terminal region containing a common neutralization epitope ... in HPV5 attachment and infection, albeit with apparently different requirements regarding sulfation, because N-desulfated and N-acetylated variants of heparin rather than the highly sulfated form ... unknown, although the availability of activated virions with a reduced affinity to heparan sulfate will potentially allow its identification Initial cell surface interactions are predominantly L1-dependent...

Ngày tải lên: 23/03/2014, 04:20

11 511 0
A nightmare journey

A nightmare journey

Ngày tải lên: 25/10/2013, 05:20

11 569 1
The Joy of Weight Loss: A Spiritual Guide to Easy Fitness doc

The Joy of Weight Loss: A Spiritual Guide to Easy Fitness doc

... Shrii Anandamurtiji T George Harris Stephen Mitchell Al Cattabiani Curtis and Julie Davis Bob and Marjorie Davis Paul and Glenna Pack Mary Sarkes and Tom Tarzian Dan Yankelovitch and Barbara Lee ... Norman Lear David Mallery Jan Miller Benjamin Robin Suzanne Bevier Fred A Billings Abby Saxon Alan Eisner Jamahl and Amity Black Alex Hood Howard Siegel, MD Susan Sarandon Deepak Chopra Arielle ... weight and stay healthy because I am in partnership with God What does that mean? Simple, I make a regular effort to stay on a balanced food plan and make sure to be active every day, in exchange...

Ngày tải lên: 29/03/2014, 04:20

207 369 0
Game Day: A Rollicking Journey to the Heart of College Football pptx

Game Day: A Rollicking Journey to the Heart of College Football pptx

... they’re able to learn a ton more from some excellent coaches—and that only makes them better Great examples are Pete Carroll of USC and Nick Saban at Alabama— they’ve been around both and have a distinct ... years, and I am a big believer in him as a coach One of his greatest assets is his ability to market and sell a program Here’s a coach who was a walk-on QB at UCLA and worked his way to a starting ... football happened in 2007 Little old Appalachian State visited the Big House and beat Michigan It was a combination of good coaching, the spread offense, and a bunch of Appalachian State players...

Ngày tải lên: 31/03/2014, 19:20

255 305 0
the tao of chemistry and life a scientific journey jun 2009

the tao of chemistry and life a scientific journey jun 2009

... nature is divided into three great domains The three great domains of life on Earth are the Archaea, the domain of archaeans, the Eubacteria, the domain of bacteria, and the Eukarya, the domain ... Methane is a simple but really important molecule Methane is a flammable gas, often called “marsh gas” or “natural gas.” Methane, as natural gas, is widely used as an energy source for domestic and ... estimates are that as many as 40% of marine organisms are archaeans, assuring that they are among the most common of Earth’s life forms.13 There should be no confusion between Eubacteria and Archaea,...

Ngày tải lên: 11/06/2014, 06:32

427 226 0
Proof of heaven, a neurosurgeons journey into the afterlife   eben alexander

Proof of heaven, a neurosurgeons journey into the afterlife eben alexander

... same way that I knew that the world around us was real—was not some fantasy, passing and insubstantial The message had three parts, and if I had to translate them into earthly language, I’d say ... intermittently groaning and flailing my arms and legs It was obvious to Dr Potter from the way I was raving and writhing around that my brain was under heavy attack A nurse brought over a crash cart, another ... reported that my birth father had been a naval aviator in Vietnam, it just blew me away: no wonder I had always loved to jump out of airplanes and fly sailplanes My birth dad was also, I was further...

Ngày tải lên: 27/07/2014, 07:49

117 964 0
Ethnographic accounts of the sathya sai baba movement   a spiritual reform oriented movement in singapore identity formation, charity giving  rationalization process

Ethnographic accounts of the sathya sai baba movement a spiritual reform oriented movement in singapore identity formation, charity giving rationalization process

... Love Home An altar at a centre SSB altar in a Chinese devotee’s house A Chinese couple offering arathi during a CNY Home bhajan A chair placed near the altar for SSB A CNY bhajan at a devotee’s ... xii Glossary Ahimsa: Non- violence Arathi: Hindu ritual in which camphor flame is offered to deities Ashram: Abode Avatar: An incarnation Bhajan: A song of devotional love, from a root related word ... Materials concerning SSB began flourishing on the net from 2000 There are substantial amounts of miracles and allegation materials as well as negative propaganda alongside with materials praising...

Ngày tải lên: 05/10/2015, 21:32

222 413 0
Tài liệu Báo cáo " Climate change adaptation from small and medium scale hydropower plants: A case study for Lao Cai province " doc

Tài liệu Báo cáo " Climate change adaptation from small and medium scale hydropower plants: A case study for Lao Cai province " doc

... and Atmospheric-Ocean Global Circulation Models, are used to assess climate change impacts in Lao Cai Province, namely: Baseline scenario using the historical data and simulating the climate ... production; Climate change adaptation related to changes of the hydrological pattern with increased floods, such as increased occurrences of flash-floods, that may be alleviated by storage capacities ... downstream water supply and irrigation a) Mitigation effects Regarding climate change mitigation, two alternatives are investigated as follows: Alternative 1: Assuming that power produced by the plants...

Ngày tải lên: 13/02/2014, 12:20

9 546 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... anti-GST and anti-Flag (Sigma), and anti-PARP (Cell Signal) The ProteoExtract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) was used to extract proteins from mammalian cells according ... mRNA level is depicted as a ratio of DAPK-1 ⁄ s-DAPK-1 to actin (E, F) s-DAPK-1, DAPK-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA quantification in colon carcinoma and rectal carcinoma ... GST–s-DAPK-1, which may mask the actual cleavage band (data not shown) The higher molecular mass protein band ( 54 kDa) might result from a covalent adduct resulting from ubiquitin-like modification;...

Ngày tải lên: 18/02/2014, 17:20

11 659 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... somewhat smaller on average than those in extracts from Artemia, and by way of comparison, small heat shock /a- crystallin proteins produced in transformed bacteria usually reside as oligomers similar...

Ngày tải lên: 22/02/2014, 04:20

10 495 0
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢ 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢ 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ ... Sciences and Engineering Research Council of Canada Discovery Grant, a Nova Scotia Health Research Foundation ⁄ Canadian Institutes of Health Research Regional Partnership Plan Grant, and a Heart and ... 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢ 5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢ blue supercompetent cells (Stratagene) p26 cDNA inserts were recovered from pRSET.C plasmids by...

Ngày tải lên: 07/03/2014, 12:20

15 516 0
Báo cáo khoa học: FH8 – a small EF-hand protein from Fasciola hepatica docx

Báo cáo khoa học: FH8 – a small EF-hand protein from Fasciola hepatica docx

... studies, an ORF corresponding to a 69 amino acid protein was isolated from a screen of an F hepatica cDNA bank [8] This protein was called FH8, because of its molecular mass of kDa, and was detected ... programs [41] We used CaM from R norvegicus, as X-ray crystallographic coordinates for both states, apo and Ca2+-loaded, were available The molecular model of TnC from M musculus (Protein Data Bank ... & Carmona C (1997) Proteinases secreted by Fasciola hepatica degrade extracellular matrix and basement membrane components J Parasitol 83, 1–5 Maizels RM & Yazdanbakhsh M (2003) Immune regulation...

Ngày tải lên: 15/03/2014, 00:20

14 356 0
Báo cáo khoa học: Alternative binding proteins: Affibody binding proteins developed from a small three-helix bundle scaffold potx

Báo cáo khoa học: Alternative binding proteins: Affibody binding proteins developed from a small three-helix bundle scaffold potx

... non-mammalian origin of affibody proteins was shown to be an advantage for diagnostic applications involving sandwich assays Exchanging one of the reagents in a classical two-antibody sandwich assay ... systems are also being investigated, including b-lactamase-based protein fragment complementation assay [15], staphylococcal display [16,17], microbead display [18] and ribosomal display (S Grimm and ... urinary bladder carcinomas and is a well-known target for immunotherapy via the monoclonal antibody trastuzumab (Herceptin) [52] Evaluated monovalent and divalent affibody protein constructs have...

Ngày tải lên: 23/03/2014, 07:20

9 307 0
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

... Coordinator Vishal Bodwani Proofreader Aaron Nash Kishore Shenoi Pankaj Ghanshani Indexer Tejal Daruwale Acquisition Editors Amey Kanse Kartikey Pandey Lead Technical Editor Kartikey Pandey Technical ... we mean by management? [8] Chapter The classical definition of management, as also found on Wikipedia, is as follows: Management in all business areas and organizational activities are the acts ... taking a break due to family or medical issues Disturbances can be long drawn, like the SARS (a deadly virus that spreads in the air from human-to-human) threat that created a fear of travel among...

Ngày tải lên: 23/03/2014, 13:20

328 4,5K 0
Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf

Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf

... TACTCGAGATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATGGAAAATTTAAACAATCCTGATG-3¢ Abz1(1–44): 5¢-TATACTCGAGATGTCACCTTTAAG GCAGAG-3¢ and 5¢-ATATCCATGGGCTTCTTCATC CTCGATCGC-3¢ Abz1(1–24): 5¢-TATACTCGAGAT ... 5¢-TATACTCGAGAT GTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATG GTCTCATCCATTCCTGCATAC-3¢ Abz1(45–138): 5¢TATACTCGAGATGCAGAAGCTTCTGCAAGATTT GAC-3¢ and 5¢-ATATCCATGGAAAATTTAAACAA TCCTGATG-3¢ The XhoI and NcoI sites ... N-terminal deletion, ABZ1(47–138): 5¢-TATGGATCCATGC TTCTGCAAGATTTGACAGG-3¢ and 5¢-ATATCCC GGGTTAAAATTTAAACAATCCTG-3¢ C-terminal deletion, ABZ1(1–100): 5¢-TATAGGATCCATGTCACC TTTAAGGCAGAG-3¢ and 5¢-ATACCCGGGTTATAA...

Ngày tải lên: 23/03/2014, 13:20

11 536 0
BMC Control-M 7: A Journey from Traditional Batch Scheduling to Workload Automation doc

BMC Control-M 7: A Journey from Traditional Batch Scheduling to Workload Automation doc

... one-size-fits-all approach, as there are chances that the events rather need a human decision to take place This approach can free the user from repetitive tasks, but can also increase maintenance overhead, ... that, applications that are specialized in a particular area may also require batch processing Some of these applications such as PeopleSoft Finance and SAP R/3 had to come with an in-built batch ... scheduling capability and user friendly features, tracking historical job executions and auditing user actions is also available This is because all jobs runs on the same machines are managed from a central...

Ngày tải lên: 24/03/2014, 04:21

534 1,7K 0
Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx

Báo cáo khoa học: Characterization of novel sequence motifs within N- and C-terminal extensions of p26, a small heat shock protein from Artemia franciscana potx

... G 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ 5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ ... 11222–11228 11 Sun Y, Mansour M, Crack JA, Gass GL & MacRae TH (2004) Oligomerization, chaperone activity, and nuclear localization of p26, a small heat shock protein from Artemia franciscana J Biol Chem ... measurements is gratefully acknowledged The research was funded by a Natural Sciences and Engineering Research Council of Canada Discovery Grant, a Nova Scotia Health Research Foundation ⁄ Canadian Institutes...

Ngày tải lên: 30/03/2014, 20:20

14 358 0
a journey from robot to digital human

a journey from robot to digital human

... rotating a frame about an axis by an angle will always have the same destination as rotating the original frame about the opposite axis by the negative angle in 3D space The second practical example ... artificial ears and eyes Ten years later, they created a new Wabot-2 as a musician humanoid robot that was able to communicate with a person, read a normal musical score by his eyes and play tones ... make a detailed analysis and check the results against the safety criteria and legal requirements In addition, MADYMO provides a useful simulation tool of airbag and seat-belt design as well as...

Ngày tải lên: 01/08/2014, 17:42

600 528 0
Báo cáo y học: "Four small supernumerary marker chromosomes derived from chromosomes 6, 8, 11 and 12 in a patient with minimal clinical abnormalities: a case report" pdf

Báo cáo y học: "Four small supernumerary marker chromosomes derived from chromosomes 6, 8, 11 and 12 in a patient with minimal clinical abnormalities: a case report" pdf

... malignancy after biopsy (Figure 1A, C) He also had a left vesicoureteral reflux grade III, with normal renal function His cardiac, audition and fundus of the eye examinations were normal, as was ... parts by the DFG (LI 820/22-1) and DAAD (D07/00070) Author details Pediatr a y jefe de sección de genética pediatrica del HUCA, Oviedo, Spain AbaCid-Genética Hospital de Madrid Norte Sanchinarro, ... child from healthy and non-consanguineous parents The first child was a healthy boy and the second child was also a boy who died after two days due to hyaline membrane disease and prematurity...

Ngày tải lên: 11/08/2014, 03:21

4 229 0
Báo cáo y học: "Melatonin therapy to improve nocturnal sleep in critically ill patients: encouraging results from a small randomised controlled trial" doc

Báo cáo y học: "Melatonin therapy to improve nocturnal sleep in critically ill patients: encouraging results from a small randomised controlled trial" doc

... collected from each patient at appropriately spaced intervals after the first oral dose All samples were taken from the arterial line, immediately centrifuged, and stored at -20°C until assay Plasma ... (64) Data are presented as mean (standard deviation) AUC(0–24), area under the concentration time curve between time and 24 hours; C(08), plasma concentration at a. m.; Cl/F, clearance/bioavailability ... Both maximum plasma concentration (Cmax) and AUC(0–24) (area under the concentration time curve between time and 24 hours) had a moderately strong correlation with plasma alanine transaminase concentrations...

Ngày tải lên: 13/08/2014, 10:20

9 330 0
w