a semi analytical technique for 3d field distribution simulation
Pathobiological studies of zoonotic blastocystis subtypes using in vitro model systems
Ngày tải lên :
10/09/2015, 15:53
... Dr Tao Fei and Dr i Fahad Kidwai for their support and advise I am also grateful for the support of Joshua Teo and Wu Zhaona and rest of the lab mates from Dr Tan’s lab (Alvin, Jun Hong, Han Bin, ... comparison with characteristics of cell size and peak protease activity 68 Table 2.2 Statistical evaluation of the quality of resazurin and XTT assays 69 Table 2.3 Optimized parameters for resazurin ... geographically (Tan et al., 2010; Yoshikawa et al., 2004b) An investigation of Blastocystis subtype distribution on isolates recovered from humans in Bangladesh, Germany, Japan, Pakistan, and Thailand...
- 275
- 571
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
Ngày tải lên :
17/03/2014, 10:20
... of optical density values for pellet and supernatant, multiplied by 100 The same formula was used to calculate percentage of assembly from radioactivity values Cell viability and proliferation ... Cientı´ ficas y ´ ´ Tecnicas (CONICET), Secretarı´ a de Ciencia y Tecnica de la Univer´ ´ sidad Nacional de Cordoba y Agencia Cordoba Ciencia del Gobierno ´ de la Provincia de Cordoba, Argentina 17 ... Incubation temperature was 37 °C At the stated times, aliquots were inactivated by addition of mL 5% trichloroacetic acid and heated at 90 °C for 15 Radioactivity bound to protein was measured...
- 9
- 518
- 0
Báo cáo y học: " Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions" pps
Ngày tải lên :
09/08/2014, 20:20
... Nosema ceranae 100 Nosema ceranae 100 Encephalitozoon cuniculi Antonospora locustae 99 100 97 100 Paranosema grylli ATP transporters Clade I Antonospora locustae Antonospora locustae Ancestral ATP ... from Spraguea lophii [35], Vittaforma cornea [36], Edhazardia aedis, and Brachiola algerae [37,38], but because of their very low sequence coverage no conclusion can be drawn about their overall ... of the ATP transporter family based on available amino acid sequences from a range of microsporidian parasites 1, Putative ancestral duplication of ATP transporters within the microsporidia following...
- 12
- 400
- 0
Things I Learned The Hard Way: The business adventures of a freelancer
Ngày tải lên :
02/07/2014, 21:42
... over again Monday June 12 @matuvu Outline Your Plan use S.M .A. R.T principle: specific.measurable.achievable.relevant.time framed Monday June 12 @matuvu Define Your Wage because if you don’t earn, ... have no bread on your table (define what you need by calculating all your costs) not earning enough? reconsider your business plan! Monday June 12 @matuvu Get A Good Accountant a good accountant ... @matuvu Hi, I’m Ine, a (web)designer & photographer, currently based in Ghent, Belgium (I’m also lead designer of Emphas.is) I have been a freelancer since 2000 And I made loooooads of mistakes...
- 19
- 257
- 1
Báo cáo y học: "The NFI-Regulome Database: A tool for annotation and analysis of control regions of genes regulated by Nuclear Factor I transcription factors" pdf
Ngày tải lên :
10/08/2014, 09:22
... genes annotated in the database and to improve the annotation features and abilities of the database The rate limiting step for input of data into the database is the manual reading of papers by annotators ... site databases There are a number of databases that are significantly larger than the NFI-Regulome Database as assessed by the number of binding sites annotated including TRANSFAC [16], JASPAR [17], ... NFI transcription factors Such data will be used when available Utility and Discussion Searching the database and displaying information: Basic Search Page The home page of the database is also...
- 10
- 386
- 0
The Marketing Strategy of a multinational join stock company.doc
Ngày tải lên :
27/10/2012, 16:51
... famous companies such as Toshiba(Japanese), Mitsubishi(Japanese), Trane(American) and Sanyo(Japanese) Medical and technical equipment and machinery, mainly imported from the USA, Italy, Germany ... Toshiba (Japanese), Mitsubishi (Japanese), Trane (American) and Sanyo (Japanese) These are famous brands in the world market and Vietnamese consumers highly appreciate them A multinational join ... for them, a Le Kim Hong Tu _ 5D The Marketing Strategy of a multinational join stock company multinational join stock company has a certain advantage: a multinational join stock company has always...
- 25
- 623
- 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent table ... Indicates that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on...
- 6
- 428
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
Ngày tải lên :
19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... N A A A A A A A A A A S S S S S S S S S S C C C C C C C C C C T T T T T T T T T T T T T T T T T T T T N N N N N N N N N N AthalianaB 159 PativumB 159 SoleraceaB 159 159 NtabacumB A. thalianaA...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
Ngày tải lên :
19/02/2014, 19:20
... Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation using measures ... 144 Rada Mihalcea 2005 Unsupervised large-vocabulary word sense disambiguation with graph-based algorithms for sequence data labeling In Proceedings of the Joint Conference on Human Language Technology ... International Joint Conference on Artificial Intelligence, pages 805–810 David M Blei, Andrew Y Ng, and Michael I Jordan 2003 Latent dirichlet allocation Journal of Machine Learning Research, Samuel...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... Paris, France) as template DNA MnSOD was cloned using the primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template PCR was carried ... (8%) of purified SOD samples stained for SOD activity Lane contains FeSOD and MnSOD markers (from Sigma, arrowed, lg each), lanes 2–9 as for lanes A1 to A8 , lanes 10–13 as for lanes C1 to C4 been...
- 12
- 740
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
Ngày tải lên :
06/03/2014, 15:21
... Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories ... the Earth (Sahabat Alam Malaysia), World Wildlife Fund for Nature (Malaysia), Malaysian Institute of Marine Affairs (MIMA), Malaysian Nature Society, Malaysian Fisheries Society, Environmental ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges...
- 88
- 581
- 0
The Making of a European Constitution Judges and Law Beyond Constitutive Power docx
Ngày tải lên :
07/03/2014, 02:20
... European act of examination, explanation and analysis of particular postnational assaults on the leading paradigms of modernity, but, rather, as an effort to deploy Europe as a mirror to global ... justice demands that such social reality reveals and entails.42 At the same time, however, and all indeterminacy apart, law should remain an authoritative constant, an organising beacon around which ... exact reach of an individual European right within national legal orders, as well as any national judgment applying or not applying that right, represents an act of legal reasoning and application...
- 257
- 364
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... 22 pKa calculations pKa values for Asp140, Asp142, Glu144 and Asp215 were calculated in several ChiB mutants as described in Materials and methods (Table 3) Calculations were primarily based ... formation was linear for at least 20 min, at all substrate concentrations, at almost all pH values and for all mutants) In this way kinetic parameters could be determined with sufficient accuracy despite ... Asp140, Asp142, Glu144 and Asp215 were mutated individually to asparagine and alanine, Tyr10 and Tyr214 were replaced by Phe, and Ser93 was replaced by alanine All clones expressing ChiB variants...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
Ngày tải lên :
08/03/2014, 02:21
... including estimated values for additional ¯ transformed internal states (A) ¯ III Reform transition probability A( i) : Each internal state Si reforms a new × transi¯ tion probability matrix A, which ... transition status for the transform matrix The ¯ formula for the estimated cells in A are: ¯ I Calculate the observation probabilities O: Every observation in each internal state Si is re-calculated ... model can traverse to a sequence of production states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b)...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
Ngày tải lên :
08/03/2014, 09:20
... mapping has been evaluated for PPA, an a- amylase studied by us earlier Also an attempt has been made to use this program for subsite mapping of other a- amylases found in the literature Evaluations ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... 79–82 Haegele, E.O., Schaich, E., Rauscher, E., Lehmann, P & Grassl, M (1981) Action pattern of human pancreatic alpha-amylase on maltoheptaose, a substrate for determining alpha-amylase in serum...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
Ngày tải lên :
08/03/2014, 22:20
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian protein ... length and contains an 867-bp ORF, which encodes for a protein with 289 amino acids and a calculated molecular mass of 32 kDa A search of the nonredundant protein sequence database was performed ... 136, 630–637 16 Nakamura, H., Matsuda, M., Furuke, K., Kitaoka, Y., Iwata, S., Toda, K., Inamoto, T., Yamaoka, Y., Ozawa, K & Yodoi, J (1994) Adult T cell leukemia-derived factor/human thioredoxin...
- 9
- 533
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
Ngày tải lên :
08/03/2014, 22:20
... H (1969) ATP citrate lyase (citrate-cleavage enzyme) Methods Enzymol 13, 153160 18 Rashid, N., Morikawa, M., Nagahisa, K., Kanaya, S & Imanaka, T (1997) Characterization of a RecA/RAD51 homologue ... gel was dried by RAPIDRY gel-dry system (ATTO, Tokyo, Japan) for 90 at 80 C and used for autoradiography ATP and ADP were separated and detected by thin layer chromatography (TLC) with a previously ... C; lane 3, same as in lane before addition of mM citrate; lane 4, enzyme after addition of mM citrate and incubation for 15 at 30 C with the sample in lane Molecular masses (kDa) are indicated...
- 8
- 551
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
Ngày tải lên :
14/03/2014, 13:20
... 0.35 For studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained ... Hoang, M.H Hanh / VNU Journal of Science, Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters ... method realized here will be extended to the case of multimode random microlaser afterwards Acknowledgements This work was supported by National Fundamental Science Research Program under Grant N0...
- 4
- 343
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
Ngày tải lên :
14/03/2014, 22:20
... Lemma 4.11, we obtain a universal constant < λ < and an integer N ≥ such that for every n ≥ N , area(P An+2 ) ≥ λ area(P ∪ P ) for all P An , area(P (4.20) An+2 ) ≥ λ area(P ∪ P ) for all P An ... makes an angle of π/3 with S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ... rational maps with Siegel disks; see for example [P2] and [Mc2] for the case of quadratic polynomials, and [Z1] and [YZ] for variants in the case of cubic polynomials and quadratic rational maps...
- 53
- 383
- 0