a pure project organization structure means one in which
Báo cáo hóa học: " A common fixed point theorem for a commuting family of nonexpansive mappings one of which is multivalued" pdf
Ngày tải lên :
20/06/2014, 22:20
... Chiang Mai University, Chiang Mai 50200, Thailand
Authors’ contributions
All authors read and approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Received: ... Math Anal
Appl. 312, 478–487 (2005). doi:10.1016/j.jmaa.2005.03.055
2. Shahzad, N, Markin, J: Invariant approximations for commuting mappings in CAT(0) and hyperconvex spaces. J Math
Anal Appl. 337 ... Math
Math Sci 1–9 (2008). Article ID 163580
11. Razani, A, Salahifard, H: Invariant approximation for CAT(0) spaces. Nonlinear Anal. 72, 2421–2425 (2010). doi:10.1016/j.
na.2009.10.039
12. Shahzad,...
- 10
- 395
- 0
Tài liệu Improving Child Health in Cambodia: Social Marketing of Diarrhea Treatment Kit, Results of a Pilot Project pdf
Ngày tải lên :
12/02/2014, 19:20
... critical in
urban and peri-urban areas where caregiv-
ers have more access to financial means and
greater availability of alternative treatments.
Lesson 4: The availability of anti-diarheal products ... placed based approach using mass
media and IPC in conjunction can improve awareness
and use of the DTK.
The communication approaches appear to
have been successful in increasing brand
awareness ... ensured that the pro-
gram was able to reach the target popu-
lations in rural areas of Siem Reap and
Pursat. The partnerships also facilitated
an extensive training program of partners
and providers...
- 19
- 438
- 1
Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot
Ngày tải lên :
21/02/2014, 15:20
... plaques in the proteinaceous parts of calciđed
stones known as corpora amylacea has recently been
reported [28]. Such stones form in the mammary gland
during lactation and contain a group of amyloid-staining
peptides ... data originating in
artefacts from b uer bands have b ee n cut out in some p laces.
Fig. 5. The backscattered R aman and ROA spectra of rec ombinant
human wild-type tau46 (top pair) and the tau ... ROA s pectrum of b-casein may have
a similar o rigin. The two caseins also show signiđcant
negative ROA intensity at ằ 1220 cm
)1
for which evidence is
accumulating that this originates in a...
- 9
- 667
- 0
Báo cáo khoa học: A ‘pure’ chemoattractant formylpeptide analogue triggers a specific signalling pathway in human neutrophil chemotaxis potx
Ngày tải lên :
07/03/2014, 16:20
... NH
2
-terminal regulatory domain containing
binding sites for Ca
2+
, phosphatidylserine and diacyl-
glycerol, a small central hinge region and a COOH-
terminal catalytic domain [9–11]. Upon activation, ... through the activation of
phospholipase (PL) C, PLD and PLA
2
, and rapidly
stimulates phosphatidylinositol-3-kinase, as well as
activating tyrosine phosphorylation. An increase in
intracellular levels ... cAMP [6,7] and the involvement
of kinases, such as protein kinase C (PKC) and mito-
gen activated protein kinases (MAPKs) [Jun N-ter-
minal kinases (JNK), p38 and extracellular response
kinase...
- 9
- 206
- 0
Critical Chain: A New Project Management Paradigm or Old Wine in New Bottles? pdf
Ngày tải lên :
16/03/2014, 01:20
... system capacity might mean investing in
IT infrastructure, additional management training, etc. In certain
cases, elevating the system constraints may be carried out by the
offloading mechanism, ... 4Engineering Management Journal
are placed wherever a non-critical chain activity leads into a CC
activity. Float is minimized by starting non-critical path activities
at their late start date. ... removing
safety margins from individual activities on the CC and adding a
project buffer at the end of the critical chain to provide a global
safety margin. A project buffer is essentially a...
- 15
- 531
- 0
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx
Ngày tải lên :
18/03/2014, 02:20
... strength and
formation (Swanson 1950). Guar gum is a branched galactomannan polymer which
has a linear 1-4 ȕ-D-mannan backbone with 1-6-linked Į-D-galactose side groups on
approximately every ... (side groups), that can again carry
galactopyranose, fucopyranose, and arabinofuranose residues (Dumitriu 2005; Zhou
et al. 2007). Xyloglucan from tamarind, a commercial product, has only xylose ... the attained paper
properties (McKenzie 1964).
Guar gum galactomannan. Certain vegetable gums, like locust bean gum, karaya
gum, and guar gum, have shown excellent effects in improving paper...
- 89
- 701
- 1
Organizational Structure and Performance in European Banks: A Reassessment pptx
Ngày tải lên :
29/03/2014, 09:20
... state owned
savings banks are German, Austrian and Swiss saving banks. Our data also include
some Portuguese savings banks (Table 1). Private savings banks, in turn, are present
mostly in ... first include all financial intermediaries that were classified as
cooperative banks, commercial banks, savings banks, real estate / mortgage banks,
bank holding and holding companies, and governmental ...
prevailing financial system in each economy, and the authors did find that in bank-
based countries savings banks have significant cost efficiency advantages over those
operating in market-based...
- 25
- 424
- 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
Ngày tải lên :
30/03/2014, 13:20
... the N-terminal fragment
of the poneratoxin gene. Two others: forward 5Â-GCC
GCCCGTGATACAGGCGATCCACGATGCGCAGA
GGTAGTAATGAG-3Â and reverse 5Â-AATTCTCATTA
CTACCTCTGCGCATCGTGGATCGCCTGTATCAC
GGG-3Â ... construction of
the poneratoxin gene [11]. Two oligonucleotides: forward
5Â-
2
GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT
CTCTTCTGATGAC-3Â and reverse 5Â-CGGCGTCATCA
GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA
CATG-3Â, were ... column.
Fractions containing the recombinant poneratoxin are indicated with
the arrow. (C) Purified recombinant poneratoxin was analyzed on
20% SDS/PAGE and revealed with silver stain. Lane 1, fractions no.
49–51;...
- 10
- 696
- 0
Báo cáo khoa học: "A CONSIDERATION ON THE CONCEPTS STRUCTURE AND LANGUAGE IN RELATION TO SELECTIONS OF TRANSLATION EQUIVALENTS OF VERBS IN MACHINE TRANSLATION SYSTEMS" doc
Ngày tải lên :
31/03/2014, 17:20
... Associated Information
So we turn our standpoint and take natural
categories of nouns (concepts) as a base and
associate to it through case relation pairs of a
verb and its translation equivalent. ... can
be associated in common to a part of the
structure of the categories as in Fig.l, and
then find appropriate translation equivalents in
detail at the lower level categories.
(2) To each ... categories in the given concepts
structure and find a nouns group to which we
associate the translation equivalent.
In this manner, we can find pairs of verb and
its translation equivalent for any...
- 3
- 394
- 0
The Interrelationship between Job Satisfaction and Job Performance - A Case of Staffs Educating from Project of Human Resources Development in Danang City
Ngày tải lên :
18/04/2014, 16:24
... control variables (namely Gender, Educational level,
Country training, Occupational class, Experience, Tenure, Age,
Marital status, Salary) play a moderator to affect job
satisfaction and job ... to Indian Work Scenario. Journal of
Indian Academy of Applied Psychology, 35, 294-299.
4
1. Introduction
1.1 Research Background
O Job satisfaction plays an important role in managing human ... strategies of organizations. It can be said that the
importance of effective managing human resources strategies
greatly depend on how well employees are being satisfied in
that organization.
O...
- 32
- 695
- 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
Ngày tải lên :
18/06/2014, 16:20
... data workup, statistical analysis and drafted the manuscript, VS
was involved in technical assistance and in writing the manuscript, HD
carried out H&E staining and CK19 IHC, CS coordinated ... harder
compared with formalin fixed material and requires a spe-
cial training. The OSNA lysate can be asservated and in
unclear cases RNA isolation for further diagnostics is
possible.
Our findings ... staging of lymph atic metastases in CRC and
enables the examination of whole LN. It can be applied as a rapid diagnostic tool to estimate tumo ur involvement
in LN during the staging of CRC.
Introduction
Carcinomas...
- 6
- 535
- 0
báo cáo hóa học: " Educators'''' working conditions in a day care centre on ownership of a non-profit organization" pot
Ngày tải lên :
20/06/2014, 00:20
... using this program information could be gained about main and
secondary activities and quantitative information about direct child contact. All activities
(main and secondary) were recorded in ... mainly caused by an
interaction of minor strains which sum up in their negative effect [3].
Beside caring and
educational duties pedagogical staff is confronted with additional tasks from a ... rotations that educators do within single working hours are
shown in Figure 1.
18
Table 2 Average times for main activities performed by educators
Sum main Average SD main
Categories activity...
- 22
- 257
- 0
Project Progress Report: " A blueprint for sustainable smallholder pig production in Central Vietnam" potx
Ngày tải lên :
21/06/2014, 06:20
... which was filmed by
a local cameraman, in September last year.
Each farmer club has a leader, a communal library and some communal medicines.
Database
We spent one day in the NIAH office, ... to finalise plan for DVD preparation and filming.
5. Offer support for the teams conducting the final farm audits and uploading data onto the online database.
7
APPENDIX 1: Phase One: ... ETEC infection was made on the appearance of watery diarrhoea and
dehydration and Lincospectin was chosen as the most appropriate medication. The following day
it was reported that the pigs had...
- 18
- 415
- 0
