a price adjustment process for managing congestion in electricity transmission networks

a system for managing experiments in data mining

a system for managing experiments in data mining

... sampling method, the dataset is split into training data and validation data For each split, the training is done on training data and tested across the validation data The results are then averaged ... forward and can be easily understood The main entities identified are rawdata, ruledata, testdata, experimentdata Raw data contains all information about the data and attributes of the dataset ... provides a wide set of data mining algorithms which help in solving business problems Access to Oracle Database also has access to Oracle Data Mining Oracle Data Mining also helps in making predictions...

Ngày tải lên: 30/10/2014, 20:01

64 319 0
A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf

A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf

... known, and the correction of such faults in adult life is a matter of considerable care and effort This manual has been prepared for practical use in the school-room and for the use of families and ... the form supported by the best authority This may be illustrated by such words as abdomen, acclimate,appendicitis, candelabrum, data, finance, ignoramus, gratis, etc There are many words in our ... ultimate standard of pronunciation for the English language is the usage that prevails among the best-educated portion of the people to whom the language is vernacular; or, at least, the usage that...

Ngày tải lên: 22/03/2014, 16:22

156 470 0
Guidelines for Managing Risks in Recreational Water docx

Guidelines for Managing Risks in Recreational Water docx

... GUIDELINES FOR MANAGING RISKS IN RECREATIONAL WATER Characteristic Cyanobacteria and algae in coastal and estuarine waters Guideline Coastal and estuarine recreational water bodies should not contain: ... of this information may be available in the Australian Beach Safety and Management Program (ABSAMP3), an inventory of all Australian beaches and their characteristics Information about measures ... temporal and spatial variations in the area (which may arise from seasonality, tidal cycles, rainfall, and discharge and abstraction patterns) Analytical sampling should provide a dataset suitable...

Ngày tải lên: 23/03/2014, 11:20

216 765 0
Báo cáo khoa học: "A Feedback-Augmented Method for Detecting Errors in the Writing of Learners of English" docx

Báo cáo khoa học: "A Feedback-Augmented Method for Detecting Errors in the Writing of Learners of English" docx

... tagging rules not classify instances as mass or count in some cases These unclassified instances are tagged with the symbol “?” Unfortunately, they cannot readily be included in training data For ... implementation, they are excluded from training data Note that the tagging rules can be used only for generating training data They cannot be used to distinguish mass and count nouns in the writing ... training data All we need to is to collect words in from the training data Here, the words in Table are excluded Also, function words (except prepositions), cardinal and quasi-cardinal numerals,...

Ngày tải lên: 23/03/2014, 18:20

8 502 0
báo cáo hóa học: " Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale" pptx

báo cáo hóa học: " Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale" pptx

... participation from academics and clinicians in our partner African clinical settings In line with our approach to partnering research in Africa, we have included all colleagues who made a substantive contribution ... http://www.hqlo.com/content/8/1/10 appropriate tool, and to incorporate this brief and valid measure into routine clinical audit The APCA African POS has now been adopted in a number of clinical audit and longitudinal research ... care sites, in South Africa and in Uganda, based in rural, periurban and urban areas, including homecare, day care and inpatient facilities Two of the sites provide care from the point of diagnosis...

Ngày tải lên: 18/06/2014, 19:20

9 477 0
Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot

Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot

... AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA GGAGCT AGGAAAAAAATCGATCGCGTTAAGATACATTGAGTTTGGA C PCR to check pAd5CMV-EGFP GGCACCAAAATCAACGGGAC AGGAAAAAAATCGATCGCGTTAAGATTACATTGAGTTTGGA C Amplification of TK from pMBP-TK AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC ... GATAACAGATTTAAATCCTTCGAACAGAATCGAT GGCCATCGATTCTGTTCGAAGGATTTAAATCTGTT PCR to check pAd5CMV/TCS CGTGTCATATGGATACACGGG TCCAGCATGGCTACAACCTC EGFP amplification from pEGFPC3 AGGAAAAAAATTTAAATCCACCATGGTGAGCAAGGGCGA ... AGGAAAAAAATTTAAATGCGCGTATGGCTTCGTAC AGGAAAAAAATTTAAATGAGTTAGCCTCCCCCATC AGGAAAAAATTCGAATCAGTTAGCCTCCCCCATC plasmid was then used to replace the E3 region by the CMVp and TCS, in pTG3622, using...

Ngày tải lên: 20/06/2014, 01:20

4 451 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS2 pot

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS2 pot

... guidelines and manuals for household aquaculture in the North Central of Vietnam iii) To build capacity for improved VAC application among stakeholders involving in aquaculture product market chains, ... improved VAC materials available regionally and internationally; construction of questionnaire and interviewing of existing farming communities who are participating in the traditional VAC systems, ... farming (includes aquaculture, horticulture and animal husbandry practices) and identify incentives and constraints for improved VAC application ii) To develop appropriate improved VAC guidelines...

Ngày tải lên: 21/06/2014, 04:20

7 352 1
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS4 pptx

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS4 pptx

... r.fotedar@curtin.edu.au In Australia: Administrative contact Name: As mentioned above Position: Organisation Telephone: Fax: Email: In Vietnam Mr Vo Van Binh Telephone: Head of environment Fax: Department ... Building A capacity building initiative has commenced at CEDMA The transfer of technology in the area of water RAS, nutrient recycling across various farming components of VAC practices and environmental ... measures are the collection of improved VAC materials available regionally and internationally; construction of questionnaire and interviewing of existing farming communities who are participating...

Ngày tải lên: 21/06/2014, 04:20

8 417 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS7 pptx

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS7 pptx

... Farmers in Thanh Hoa Earthworm + Snake head in tanks Earthworm + Snake head in tanks Earthworm + Snake head in tanks Snake head in tanks Snake head in tanks Earthworm Business Earthworm + snake head ... workshop in Hue Training workshop in Quang tri This workshop was for participants among project provinces including; Thanh Hoa, Nghe An, Ha Tinh, Quang Binh Quang Tri and Hue The workshop gave participants ... Training for two CEDMA staff in Australia Duration: The training in Australia took place between February 13th to March 8th 2010 Venue: Curtin University, Perth, Australia Purpose: Consolidation and...

Ngày tải lên: 21/06/2014, 04:20

13 344 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities - Milestone 5 " ppt

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities - Milestone 5 " ppt

... Water parameters were within acceptable ranges for fish health and growth Examination of dead fish suggested that the mass mortality of eels one week after stocking was a result of transportation ... improved VAC system; • Suitable for farms where ponds are non-existent or, exist but are of an area less than 200m2 particularly in areas of limited access to water, • Availability of raw materials ... medium include cattle and poultry manures and by-products, such as straw plant wastes from agriculture • Rearing container 14 Containers should be in a suitable and convenient location that is,...

Ngày tải lên: 21/06/2014, 04:20

15 413 0
Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS8 ppt

Báo cáo khoa học nông nghiệp " Improving traditional integrated farming systems (VAC) – a new livelihood option for poor farmers in the coastal communities " MS8 ppt

... farmers in Central Vietnam through environmentally sustainable aquaculture , background information and data was collected in the provinces of; Thanh Hoa, Nghe An, Ha Tinh, Quang Binh and Quang ... and goby (in sites each) In addition, a hatchery which can produce grass carp, silver carp and common carp larvae has been included in a demonstration site in Quang Binh It was found that snake ... improved VAC materials available regionally and internationally; • Construction of questionnaire and interviewing of existing farming communities who are participating in the traditional VAC systems;...

Ngày tải lên: 21/06/2014, 04:20

9 481 0
báo cáo hóa học:" Strong and weak convergence of an implicit iterative process for pseudocontractive semigroups in Banach space" pdf

báo cáo hóa học:" Strong and weak convergence of an implicit iterative process for pseudocontractive semigroups in Banach space" pdf

... Yibin, Sichuan 644000, China College of Statistics and Mathematics, Yunnan University of Finance and Economics, Kunming, Yunnan 650221, China ∗ Corresponding author: Jing Quan (E-mail: quanjingcq@163.com), ... strong convergence theorems of fixed points in an arbitrary Banach space based on an implicit iterative algorithm Theorem A Let E be an arbitrary Banach space and K a nonempty closed convex subset of ... ∈ C for a finite family of nonexpansive mappings {Ti }N and proved some weak convergence theorems to a common fixed point for i=1 a finite family of nonexpansive mappings in a Hilbert space In 2004,...

Ngày tải lên: 21/06/2014, 17:20

11 253 0
Báo cáo nghiên cứu nông nghiệp " Improving traditional integrated farming systems (VAC) - a new livelihood option for poor farmers in the coastal communities " pptx

Báo cáo nghiên cứu nông nghiệp " Improving traditional integrated farming systems (VAC) - a new livelihood option for poor farmers in the coastal communities " pptx

... acceptable range for aquatic animals outlined in the National Standard for Water Quality (TCVN, 1995; 2000) Snakehead (Channa maculatus) was stocked at density of 10 fish/m² The water level in ... Water quality parameters tested during the culture indicated a suitable range for growth of aquatic animals, including for snakehead fish Surrounding environment Culturing snakehead in tanks has three ... circulation in the air-breathing snakehead fish, Channa punctata, C gachua, and C marulius (Ophiocephalidae, Ophiocephaliformes) MeSH – Anat Rec Department of Zoology, Bhagalpur University, India...

Ngày tải lên: 22/06/2014, 13:20

8 454 3
Báo cáo toán học: "A Fixed Point Theorem for Nonexpansive Mappings in Locally Convex Spaces" ppt

Báo cáo toán học: "A Fixed Point Theorem for Nonexpansive Mappings in Locally Convex Spaces" ppt

... Uniformly lipschitzian families of transformations in Banach spaces, Canad J Math 26 (1974) 1245–1256 W A Kirk, A fixed point theorem for mappings which not increase distances, Amer Math Monthly 72 ... set and T (K) ⊂ K} A Fixed Point Theorem for Nonexpansive Mappings in Locally Convex Spaces 151 Clearly F is a nonempty family, since C ∈ F By weakly compactnees of C and Zorn’s Lemma, F has a ... ) in a probabilistic normed space are understood as those in the corresponding locally convex space Definition A mapping T in (X, F , min) is said to be probabilistic nonexpansive if for all x,...

Ngày tải lên: 06/08/2014, 05:20

7 297 1
Báo cáo lâm nghiệp: "A fire probability model for forest stands in Catalonia (north-east Spain)" pptx

Báo cáo lâm nghiệp: "A fire probability model for forest stands in Catalonia (north-east Spain)" pptx

... ICONA, Segundo Inventario Forestal Nacional (1986–1995) Catalu a: Tarragona, MAPA, Madrid, 1993 [13] Jalkanen A. , Mattila U., Logistic regression models for wind and snow damage in northern Finland ... [10] ICONA, Segundo Inventario Forestal Nacional (1986–1995) Catalu a: Girona, MAPA, Madrid, 1993 [11] ICONA, Segundo Inventario Forestal Nacional (1986–1995) Catalu a: Lleida, MAPA, Madrid, 1993 ... Pinus sylvestris L and Pinus nigra Arn in Catalonia, north-east Spain, Ann For Sci 61 (2004) 409–417 [26] Trasobares A. , Pukkala T Optimising the management of unevenaged Pinus sylvestris L and...

Ngày tải lên: 08/08/2014, 00:22

8 297 0
báo cáo khoa học: " HIV as a chronic disease considerations for service planning in resource-poor settings" docx

báo cáo khoa học: " HIV as a chronic disease considerations for service planning in resource-poor settings" docx

... Colebunders R, Kamya MR, Laurence J, Kambugu A, Byakwaga H, Mwebaze PS, Muganga AM, Katwere M, Katabira E: First-line antiretroviral therapy in Africa - how evidence-based are our recommendations? AIDS ... S, Akabayashi A, Kai I, Ohi G, Naka K: Correlation between history of contact with people living with HIV/AIDS (PWAs) and tolerant attitudes toward HIV/AIDS and PWAs in rural Thailand International ... S, et al: Rates of virological failure in patients treated in a home-based versus a facility-based HIV-care model in Jinja, southeast Uganda: a cluster-randomised equivalence trial The Lancet...

Ngày tải lên: 11/08/2014, 14:21

6 291 0
Báo cáo khoa học: "Rapid molecular detection of methicillin-resistant Staphylococcus aureus: a cost-effective tool for infection control in critical care" pdf

Báo cáo khoa học: "Rapid molecular detection of methicillin-resistant Staphylococcus aureus: a cost-effective tool for infection control in critical care" pdf

... Critical Care Vol 10 No Struelens and Denis endemic MRSA in The Netherlands and Scandinavia [5,6] Clinical practice recommendations include MRSA carrier screening to inform patient isolation and ... unisolated MRSA patient-days avoided, the number of unnecessary preemptive isolation days avoided, the increase in the MRSA decolonization rate, the decrease in the MRSA transmission and infection ... Mathematical modeling suggest that using a rapid PCR Page of (page number not for citation purposes) assay for MRSA admission screening and patient isolation should reduce significantly the incidence...

Ngày tải lên: 12/08/2014, 23:22

3 222 0
Báo cáo y học: "Introduction of a pyramid guiding process for general musculoskeletal physical rehabilitation" pot

Báo cáo y học: "Introduction of a pyramid guiding process for general musculoskeletal physical rehabilitation" pot

... that the treating physician and/or therapist will have determined that a patient is beyond the acute phases of inflammation control and that, based on objective data, they are a good candidate ... This author encourages feedback and discussion on rationale for changes and improvements in this process for enhanced safety and efficacy of patient management and clinician education Competing interests ... http://www.chiroandosteo.com/content/14/1/9 clinician feels comfortable that the patient's stabilizer muscles have achieved an appropriate level of conditioning and will aid in protecting and stabilizing the joint, it may be safe and...

Ngày tải lên: 13/08/2014, 14:20

6 223 0
Báo cáo y học: "Exploring systemic RNA interference in insects: a genome-wide survey for RNAi genes in Tribolium" potx

Báo cáo y học: "Exploring systemic RNA interference in insects: a genome-wide survey for RNAi genes in Tribolium" potx

... proteins are assigned to the siRNA and miRNA pathways in Drosophila [17] Dcr-1, which retains a PAZ domain but lacks an amino-terminal helicase domain (Figure 1c), is involved in the miRNA pathway ... contains a long amino-terminal extracellular domain followed by an array of transmembrane domains, which are inferred to form a channel for dsRNA molecules [53,59] Mosaic analysis in C elegans using ... (Piwi/Argonaute/Zwille) domain, tandem RNase III domains and a carboxy-terminal dsRNA binding domain A single Dicer protein is involved in both the siRNA and miRNA pathways in C elegans [67-69] In contrast, different...

Ngày tải lên: 14/08/2014, 08:20

22 223 0
w