a potential threat for wild fish assemblages under protection regimes
Tài liệu Commodity-Linked Bonds: A Potential Means for Less-Developed Countries to Raise Foreign Capital doc
... Monetary and Financial Analysis Department Bank of Canada Ottawa, Ontario, Canada K 1A 0G9 jattamensah@bankofcanada.ca The views expressed in this paper are those of the author No responsibility for ... Ottawa, Ontario K 1A 0G9 E-mail: publications@bankofcanada.ca Web site: http://www.bankofcanada.ca Diffusion des publications, Banque du Canada 234, rue Wellington, Ottawa (Ontario) K 1A 0G9 Adresse ... Bank of Canada Working Papers Documents de travail de la Banque du Canada Working papers are generally published in the language of the author, with an abstract in both official languages Les...
- 43
- 870
- 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... of anti-placental alkaline phosphatase-agarose (anti-PLAP; Sigma) was packed into an FPLC column (Amersham Biosciences, Chalfont St Giles, UK) Purification of FN3d–AP was carried out using an AKTA ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system ... cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated...
- 14
- 669
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae ... Cyanobacteria Synechocystis sp PCC6803 Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana ... gyrans (B), Laminria japonica (C) and Undaria pinnatifida (D) with antibodies raised against various extrinsic proteins Lane 1, anti-(H-PsbP); lane 2, anti-(H-PsbQ); lane 3, anti-(G-PsbQ); lane...
- 11
- 501
- 0
Báo cáo hóa học: " Research Article A Continuation Method for Weakly Contractive Mappings under the Interior Condition" pot
... invariant by a certain class of homotopies, obtaining as a consequence a Leray-Schauder alternative for weakly contractive maps in the setting of a Banach space We prove here that the Leray-Schauder ... Spain, 1996 D O’Regan and R Precup, Theorems of Leray-Schauder Type and Applications, vol of Series in Mathematical Analysis and Applications, Gordon and Breach Science, Amsterdam, The Netherlands, ... Suppose that U is an open and strictly star shaped subset of a Banach space X, · , with ∈ U, and that f : U → X is map with f U being bounded Assume also that there exists a ∈ 0, such that for all...
- 8
- 304
- 0
Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf
... severe forms of anorexia nervosa Upon primary medical stabilization, patients are transferred to a psychiatrically based inpatient eating disorder program further treatment and follow-up Patients and ... the traditional activation cascade using C3 convertases or C5 convertases [13] As a result, C 5a may be generated via thrombin-mediated coagulation abnormalities that have been documented in anorexia ... power of our statistical analysis and make our data vulnerable to a statistical type II error Therefore, our data not allow for advocating complement serum levels as a new biomarker until definitively...
- 6
- 441
- 0
Báo cáo y học: "tatin-induced expression of CD59 on vascular endothelium in hypoxia: a potential mechanism for the anti-inflammatory actions of statins in rheumatoid arthritis" pptx
... UK) Statistical analysis All data were expressed as the mean of the individual experiments ± the standard error of the mean Data were analysed using one-way or two-way analysis of variance with ... Capell HA, Sattar N: Trial of Atorvastatin in Rheumatoid Arthritis (TARA): double-blind, randomised placebo-controlled trial Lancet 2004, 363:2015-2021 Palmer G, Chobaz V, Talabot-Ayer D, Taylor ... tissue factor procoagulant activity J Exp Med 1997, 185:1619-1627 36 Collard CD, Agah A, Reenstra W, Buras J, Stahl GL: Endothelial nuclear factor-kappaB translocation and vascular cell adhesion...
- 12
- 510
- 0
Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf
... Maldonado-Cocco J, Orozco-Alcala J, Prieur AM, Suarez-Almazor ME, Woo P, International League of Associations for Rheumatology: International League of Associations for Rheumatology classification ... participated in its design and coordination, and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Taschawee Arkachaisri, Daniel ... thermal imaging of the wrist and MCP, normal adult wrists and hands from controls were imaged on separate days Three thermal scans were obtained at each session and the HDI was calculated for each...
- 9
- 344
- 0
Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx
... study, ANA staining, saliva collections, data analyses, and manuscript preparation All authors read and approved the final manuscript Proposed genetic predisposition for and fatty acid homeostasis/trans6.NOD-Aec1Aec2 ... O-acyltransferase-1 (SOAT-1) using FCs and free fatty acids (FFAs) ABCA1, ATP-binding cassette, subfamily A [ABC1] member 1; ACAT, acyl-coenzyme A: cholesterol acyltransferase; ApoE, apolipoprotein ... primarily the pathophysiological and biochemical abnormalities that subsequently result in the activation of the autoimmune attack against the submandibular and lacrimal glands [10], is a single...
- 12
- 399
- 0
Báo cáo khoa học: "Combined effects of hyperglycemic conditions and HIV-1 Nef: a potential model for induced HIV neuropathogenesis" docx
... Pradhan L, Ali M, Agrawal KC: HAART drugs induce oxidative stress in human endothelial cells and increase endothelial recruitment of mononuclear cells: exacerbation by inflammatory cytokines and ... cytokines and amelioration by antioxidants Cardiovasc Toxicol 2004, 4:287-302 Gomez-Vera J, de Alarcon A, Jimenez-Mejias ME, Acosta D, Prados D, Viciana P: Hyperglycemia associated with protease inhibitors ... hyperplasia Pediatr Dev Pathol 2004, 7:370-379 Sacktor N, Haughey N, Cutler R, Tamara A, Turchan J, Pardo C, Vargas D, Nath A: Novel markers of oxidative stress in actively progressive HIV dementia...
- 14
- 250
- 0
Báo cáo y học: "Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associated with improvement - a potential target for prevention of knee osteoarthritis: a longitudinal study" pdf
... years Potential confounders of age, gender, BMI, and tibial plateau area for annual change in cartilage volume were included in multivariate analyses A P value less than 0.05 (two-tailed) was regarded ... Medial compartment Annual change in cartilage volume Cartilage defects progress vs no change Lateral compartment Annual change in cartilage volume Cartilage defects progress vs no change Annual ... coefficients of variation for the medial and lateral tibial cartilage volume measures were 3.4% and 2.0% respectively [35,36] Annual change in cartilage volume was calculated as follow up cartilage volume...
- 8
- 372
- 0
Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot
... plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; ... the E plasmid was 5'-ATCCAAGACGGAATTCCTAGAACTCGTTTTCCTGATTCTGGAG-3' and the 3' primer used for the U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified ... essential for Vif function J Biol Chem 2005, 280(19):18573-18578 Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T, Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H, Iwai K, Uchiyama...
- 13
- 254
- 0
Báo cáo y học: "Expression of infectious murine leukemia viruses by RAW264.7 cells, a potential complication for studies with a widely used mouse macrophage cell line" ppsx
... formalin fixed, paraffin embedded tissues or studied by IHC using the anti-p30 antibody, anti-CD3 for Tcell lineage identification (DAKO Corporation, Carpinteria, CA Catalog # A4 52), and anti-PAX5 ... anti-PAX5 for B-cell lineage (Goat anti-Pax 5, Santa Cruz Biotechnology, Santa Cruz, CA, Catalog #sc-1974) [14] Criteria for histopathological diagnosis were as described [15] As shown in Table 1, ... pneumonia virus of mice (PVM) in a mouse macrophage cell line Virol Journal 2007, 4:48-51 Shin J-J, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang J-I, Rebres R, Roach T, Seaman W, Simon MI, Fraser...
- 6
- 330
- 0
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot
... denaturation at 94°C for 10 s annealing at 53°C for 30 s and extension at 72°C for 40 s, followed by a final extension at 72°C for 10 The relative amount of EGFR cDNA in each sample was calculated by ... -3'; backward primer, 5'- CCTTCGCACTTCTTACACTTG -3'; probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cycler parameters included one cycle at 94°C for min, and 45 cycles involving denaturation ... 5'GGAGCUGCCCAUGAGAAAUdTdT-3' and antisense 5'AUUUCUCAUG GGCAGCUCCdTdT-3' The unrelated nonspecific dsRNAs as control were designed as following: sense 5'-GAACUUCAGGGUCAGCUUG CCdTdT-3' and antisense 5'-GGCAAGCUGACCCUGAAGUUCdTdT3'...
- 12
- 314
- 0
BARRIER DISRUPTION IN STAT6VT TRANSGENIC MICE AS A POTENTIAL MODEL FOR ATOPIC DERMATITIS SKIN INFLAMMATION
... technical aspects of this project For Dr Ravi Sahu, Dr Mohammed Al-Hassani, Dr Sarita Sehra, Dr Simarna Kaur, Qiaofang Yi, Davina A Lewis, Badri M Rashid, Evelyn T Nguyen, and Pamela Durant And finally, ... Sarasour, et al., 1995) The radial spread of SLS can elicit increased TEWL and decreased skin capacitance in areas adjacent to the application sites, as far as approximately 0.75cm away (Patil, ... of asthma and allergic diseases The IL-4 pathway cascade is mediated through the activation of the latent transcription factor, signal transducer and activator of transcription (STAT6) The STAT...
- 50
- 208
- 0
A potential target for tuberculosis drug discovery
... Clp ATPase belongs to the AAA+ superfamily of ATPases AAA+ proteins are generally modulated by a group of otherwise unrelated proteins termed adaptor proteins An adaptor protein serves as an accessory ... the same group demonstrated that mpa and pafA mutants are severely attenuated in a mouse model of infection (Darwin et al., 2005) Mpa is an ATPase that forms hexamers like the Clp ATPase Meanwhile, ... adds 11 amino acid tag (AANDENYALAA) to the incomplete protein Proteins tagged with the SsrA peptide are targeted for degradation The C-terminal Ala-Ala residues are critical for SsrA recognition...
- 114
- 215
- 0
Tài liệu AMAZONIAN ACCESSIONS OF WILD HEVEA GERMPLASM - A POTENTIAL SOURCE OF DROUGHT TOLERANCE pptx
... Tarauaca, Xapuri Rondonia – Ariquemes, Calama, Costa Marques, Jiparana, Ouro Preto, Pimenta Bueno, Jaru Mato Grosso: Aracotuba, Cartriquaca, Itauba, Vila Bella Provenance-wise conservation- India Introduced ... months in a year - average annual rain fall of 7.5mm per day - average of 90 rainy days/ year 18 First year post- drought data on range and mean of growth characters in the hot-spot region Characters ... the availability of sufficient genetic variability 1981-IRRDB germplasm collection – a valuable reservoir of genes for various abiotic stresses Acre : Brasileia, Feijo, Sena Madureira, Tarauaca,...
- 23
- 573
- 0
A Generic QSAR for Assessing the Bioaccumulation Potential of Organic Chemicals in Aquatic Food Webs pot
... this class of chemical substances a reasonable database exists that can be used for calibration Also, similar mechanisms for metabolic transformation may apply to this class of chemical substances ... the same parameters to tropical or arctic food webs Model calibration: To calibrate the model, a database was compiled of empirical BCF and BAF data for organic chemicals in fish and aquatic ... unable to predict metabolic transformation rates of chemical substances in aquatic biota However, if information on metabolic transformation rates are available from laboratory bioconcentration...
- 9
- 717
- 0
Báo cáo khoa học: Alternative substrates for wild-type and L109A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc
... phosphoribosylpyrophosphate amidotransferase [25], and the same may be true for CTPS While the presence of a phenylalanine at position 109 may impede the appropriate conformational changes required for catalysis, ... Figs and Such ratios have been used to characterize the channelling efciency of amidotransferases [41] kcat =Km ịCTP formation Subsaturatingcouplingratioẳ kcat =Km ịglutaminase activity 2ị Saturatingcouplingratioẳ ... by an operating grant from the Canadian Institutes of Health Research (S.L.B.), a Natural Sciences and Engineering Research Council (NSERC) of Canada Collaborative Health Research Project grant...
- 9
- 404
- 0
Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
... scDNA (B) Ethidium stained agarose gel: lane 1, scDNA only; lane 2, no mAb; lanes 3–6, Bp53-10.1; lanes 7–10, ICA-9 mAb/p53 tetramer molar ratios: lanes and 7, 0.5; lanes and 8, 1.25; lanes and ... supernatants or ascites by means of affinity chromatography using either protein G-Sepharose (Pharmacia) or protein L-Sepharose (Pierce) horseradish peroxidase conjugated anti-rabbit IgG (Sigma) ... lanes and 7, no mAb; lanes and 8, DO-1; lanes and 9, ICA-9; lanes and 10, Bp53-6.1; lanes and 11, Bp53-10.1 Bands denoted as ÔscÕ and ÔocÕ correspond to free monomeric scDNA and open circular...
- 12
- 265
- 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx
... areas was calculated for each group The Mean and SD of bladder tumor area (A) and weight (B) are shown Amit and Hochberg Journal of Translational Medicine 2010, 8:134 http://www.translational-medicine.com/content/8/1/134 ... the RNA STAT-60TM Total RNA/mRNA isolation reagent, according to the manufacture’s instructions The RNA was treated by RNAse-free DNAse I to eliminate any contaminating DNA Total cDNA was synthesized ... activation was reported as a major mechanism for the IGF2 overexpression in a variety of tumors including bladder carcinoma, hepatocellular carcinoma, breast cancer, ovarian cancer and prostate cancer...
- 18
- 746
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008