a potential target for anti angiogenic therapy

Báo cáo y học: "Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associated with improvement - a potential target for prevention of knee osteoarthritis: a longitudinal study" pdf

Ngày tải lên : 12/08/2014, 11:22

... years Potential confounders of age, gender, BMI, and tibial plateau area for annual change in cartilage volume were included in multivariate analyses A P value less than 0.05 (two-tailed) was regarded ... Medial compartment Annual change in cartilage volume Cartilage defects progress vs no change Lateral compartment Annual change in cartilage volume Cartilage defects progress vs no change Annual ... coefficients of variation for the medial and lateral tibial cartilage volume measures were 3.4% and 2.0% respectively [35,36] Annual change in cartilage volume was calculated as follow up cartilage volume...

8
372
0

A potential target for tuberculosis drug discovery

Ngày tải lên : 26/11/2015, 22:38

... Clp ATPase belongs to the AAA+ superfamily of ATPases AAA+ proteins are generally modulated by a group of otherwise unrelated proteins termed adaptor proteins An adaptor protein serves as an accessory ... adds 11 amino acid tag (AANDENYALAA) to the incomplete protein Proteins tagged with the SsrA peptide are targeted for degradation The C-terminal Ala-Ala residues are critical for SsrA recognition ... the same group demonstrated that mpa and pafA mutants are severely attenuated in a mouse model of infection (Darwin et al., 2005) Mpa is an ATPase that forms hexamers like the Clp ATPase Meanwhile,...

114
215
0

Báo cáo hóa học: "Anti-viral state segregates two molecular phenotypes of pancreatic adenocarcinoma: potential relevance for adenoviral gene therapy" pdf

Ngày tải lên : 18/06/2014, 16:20

... Associazione Italiana Ricerca Cancro (AIRC), Milan, Italy (AS); Fondazione CariPaRo, Padova, Italy (AS); Banco Popolare di Verona (VM); Ministero della Salute, Rome, Italy; Ministero della Salute ... gene signature for DNA damage resistance is a predictive marker for chemotherapy and radiation for breast cancer Proc Natl Acad Sci USA 2008, 105:18490-18495 21 Sorio C, Bonora A, Orlandini S, ... incubated overnight with IFN-alpha at a final concentration of 100 IU/ml Immunohistochemical analysis A tissue microarray (TMA) containing 23 primary PDACs, 11 xenografts, and normal pancreas was...

11
512
0

Báo cáo y học: "tatin-induced expression of CD59 on vascular endothelium in hypoxia: a potential mechanism for the anti-inflammatory actions of statins in rheumatoid arthritis" pptx

Ngày tải lên : 09/08/2014, 08:22

... UK) Statistical analysis All data were expressed as the mean of the individual experiments ± the standard error of the mean Data were analysed using one-way or two-way analysis of variance with ... Capell HA, Sattar N: Trial of Atorvastatin in Rheumatoid Arthritis (TARA): double-blind, randomised placebo-controlled trial Lancet 2004, 363:2015-2021 Palmer G, Chobaz V, Talabot-Ayer D, Taylor ... V, Castro MSD, Teixeira MM: Anti- inflammatory and analgesic effects of atorvastatin in a rat model of adjuvant-induced arthritis Eur J Pharmacol 2005, 516:282-289 Mason JC, Yarwood H, Sugars...

12
510
0

báo cáo khoa học: " Pyrosequencing, a method approved to detect the two major EGFR mutations for anti EGFR therapy in NSCLC" ppt

Ngày tải lên : 10/08/2014, 10:21

... 5’GCTGCGAGCTCACCCAGAATGTCTGG-3’ 62°C 5’-GAATTCGGATGCAGAGCTTCTT-3’ 5’-Biotin-CCCACA CAGCAA AGCAGAAACT-3’ 5’-Biotin-CTTTCTCTTCCGCACCCA 5’-TAAAATTCCCGTCGC-3’ 5’-CATGTCAAGACTACAGATT-3’ 61°C Dufort et al Journal ... 65:7276-7282 Tanaka T, Nagai Y, Miyazawa H, Koyama N, Matsuoka S, Sutani A, Huqun , Udagawa K, Murayama Y, Nagata M, Shimizu Y, Ikebuchi K, Kanazawa M, Kobayashi K, Hagiwara K: Reliability of the ... cancer: analysis of results in 19 patients Int J Clin Oncol 2008, 13:442-446 Nagai Y, Miyazawa H, Huqun , Tanaka T, Udagawa K, Kato M, Fukuyama S, Yokote A, Kobayashi K, Kanazawa M, Hagiwara...

7
360
0

Tài liệu Commodity-Linked Bonds: A Potential Means for Less-Developed Countries to Raise Foreign Capital doc

Ngày tải lên : 16/02/2014, 02:20

... Monetary and Financial Analysis Department Bank of Canada Ottawa, Ontario, Canada K 1A 0G9 jattamensah@bankofcanada.ca The views expressed in this paper are those of the author No responsibility for ... Ottawa, Ontario K 1A 0G9 E-mail: publications@bankofcanada.ca Web site: http://www.bankofcanada.ca Diffusion des publications, Banque du Canada 234, rue Wellington, Ottawa (Ontario) K 1A 0G9 Adresse ... Bank of Canada Working Papers Documents de travail de la Banque du Canada Working papers are generally published in the language of the author, with an abstract in both ofﬁcial languages Les...

43
870
0

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Ngày tải lên : 19/02/2014, 05:20

... of anti- placental alkaline phosphatase-agarose (anti- PLAP; Sigma) was packed into an FPLC column (Amersham Biosciences, Chalfont St Giles, UK) Puriﬁcation of FN3d–AP was carried out using an AKTA ... cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP puriﬁed from conditioned media using anti- placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system...

14
669
0

Báo cáo khoa học: The human pyridoxal kinase, a plausible target for ginkgotoxin from Ginkgo biloba docx

Ngày tải lên : 07/03/2014, 10:20

... treatment for (a) and 60 (b) with alkaline phosphase (Merck, Darmstadt, Germany; 100 U) at 37°C, as analyzed by HPLC Inﬂuence of ginkgotoxin on human pyridoxal kinase This material is available as part ... PKH leads inter alia to a decreased availability of PLP for GAD, which catalyses the formation of c-aminobutyric acid, the most potent inhibitory neurotransmitter in the mammalian brain Decreased ... membrane-bound phosphatases (Fig 2A) [13,14] Inside the brain a rephosphorylation to PLP takes place, again catalysed by pyridoxal kinase (Fig 2A) [7,14] As a consequence, there is a requirement for...

10
530
0

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21

... gyrans (B), Laminria japonica (C) and Undaria pinnatiﬁda (D) with antibodies raised against various extrinsic proteins Lane 1, anti- (H-PsbP); lane 2, anti- (H-PsbQ); lane 3, anti- (G-PsbQ); lane ... Fig Reactivities of the thylakoid membranes isolated from Cyanophora paradoxa with antibodies raised against various extrinsic proteins Lane 1, anti- (H-PsbP); lane 2, anti- (H-PsbQ); lane 3, anti- (G-PsbQ); ... lane 4, anti- (R-PsbQ¢); lane 5, anti- (R-PsbV); lane 6, anti( R-PsbU); lane 7, anti- (C-PsbU) C caldarium (Fig 1B) reacted with anti- (R-PsbV) (lane 5) and anti- (R-PsbU) (lane 6), but not with anti( C-PsbU)...

11
501
0

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Ngày tải lên : 18/06/2014, 16:20

... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and...

12
573
0

Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf

Ngày tải lên : 09/08/2014, 01:21

... severe forms of anorexia nervosa Upon primary medical stabilization, patients are transferred to a psychiatrically based inpatient eating disorder program further treatment and follow-up Patients and ... the traditional activation cascade using C3 convertases or C5 convertases [13] As a result, C 5a may be generated via thrombin-mediated coagulation abnormalities that have been documented in anorexia ... power of our statistical analysis and make our data vulnerable to a statistical type II error Therefore, our data not allow for advocating complement serum levels as a new biomarker until definitively...

6
441
0

Báo cáo y học: " Histone deacetylases — a new target for suppression of cartilage degradation" pdf

Ngày tải lên : 09/08/2014, 06:23

... Yoshida A, Yamana J, Yamamura M, Ninomiya Y, et al.: Histone deacetylase inhibitor suppression of autoantibody-mediated arthritis in mice via regulation of p16INK 4a and p21(WAF1/Cip1) expression Arthritis ... reduced as determined by real-time polymerase chain reaction In contrast, expression of the major cartilage structural molecules aggrecan and type II collagen and a number of other metalloproteinases ... metalloproteinase expression in cartilage and demonstrates that the paradigm of inhibition of histone deacetylation leading to gene silencing is not absolute Cawston and colleagues showed many years ago...

2
397
0

Báo cáo y học: " The RNA interference pathway: a new target for autoimmunity" pot

Ngày tải lên : 09/08/2014, 08:22

... RNAi machinery is that RNAi was initially recognized as an antiviral mechanism in plants and certain invertebrates [14] The evolutionary conservation of RNAi suggests a similar role for RNAi ... Gensler TJ, Anderson P: Death, autoantigen modifications, and tolerance Arthritis Res 2000, 2:101-114 Doyle HA, Mamula MJ: Posttranslational modifications of selfantigens Ann N Y Acad Sci 2005, ... the generation of anti- Su autoantibodies is initiated, whether a viral factor is involved in this process, and whether testing for these autoantibodies is clinically relevant Available online...

3
311
0

Báo cáo y học: " Is interleukin-1 a good target for therapeutic intervention in intervertebral disc degeneration: lessons from the osteoarthritic experience" pdf

Ngày tải lên : 09/08/2014, 10:21

... intra-articular delivery of anakinra (recombinant methionyl human receptor antagonist (r-met HuIL-1ra)) may have beneficial effects on symptoms and structural modifications in animal models of OA ... pain and disease activity A first randomized controlled trial in patients with knee OA demonstrated a good safety profile for one intra-articular injection of IL-1ra (150 mg, the maximum tolerated ... structural damage process of OA but also plays an important role in pain transmission Results from in vitro studies and animal models of OA support the dominant role of IL-1β early in the disease...

2
412
0

Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf

Ngày tải lên : 09/08/2014, 10:22

... Maldonado-Cocco J, Orozco-Alcala J, Prieur AM, Suarez-Almazor ME, Woo P, International League of Associations for Rheumatology: International League of Associations for Rheumatology classification ... participated in its design and coordination, and helped to draft the manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Taschawee Arkachaisri, Daniel ... purposes) Arthritis Research & Therapy Vol 10 No Spalding et al Table Reproducibility of wrist and metacarpalphalangeal three-dimensional measures across sessions 3D measure Wrist Metacarpophalangeal...

9
344
0

Báo cáo y học: "DREAM is reduced in synovial fibroblasts of patients with chronic arthritic pain: is it a suitable target for peripheral pain management" pptx

Ngày tải lên : 09/08/2014, 10:23

... 5'-AAGGACAGGATCCACTTGACCTATAGTGAGTCGTATTA-3' 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3' siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' ... 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3' siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3' T7 5'-TAATACGACTCACTATAG-3'...

8
576
0

Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx

Ngày tải lên : 09/08/2014, 13:22

... study, ANA staining, saliva collections, data analyses, and manuscript preparation All authors read and approved the final manuscript Proposed genetic predisposition for and fatty acid homeostasis/trans6.NOD-Aec1Aec2 ... Detection of anti- nuclear autoantibodies in the sera Anti- nuclear autoantibodies (ANAs) in the sera of mice were detected using an ANA screening kit (Immuno Concepts, Sacramento, CA, USA) Sera were ... O-acyltransferase-1 (SOAT-1) using FCs and free fatty acids (FFAs) ABCA1, ATP-binding cassette, subfamily A [ABC1] member 1; ACAT, acyl-coenzyme A: cholesterol acyltransferase; ApoE, apolipoprotein...

12
399
0

báo cáo khoa học: " Polymeric nanoparticle-encapsulated curcumin ("nanocurcumin"): a novel strategy for human cancer therapy" ppsx

Ngày tải lên : 11/08/2014, 00:22

... proliferation and antiapoptotic and metastatic gene products through suppression of IkappaBalpha kinase and Akt activation Mol Pharmacol 2006, 69:195-206 Hidaka H, Ishiko T, Furuhashi T, Kamohara H, ... triplicates to determine means and standard deviations Colony assays in soft agar Colony formation in soft agar was assessed for therapy with free curcumin and equivalent dosage of nanocurcu- Page ... Asia [1] For centuries, turmeric has been used as a spice and coloring agent in Indian food, as well as a therapeutic agent in traditional Indian medicine Enthusiasm for curcumin as an anti- cancer...

18
312
0

báo cáo khoa học: "Free Rhodium (II) citrate and rhodium (II) citrate magnetic carriers as potential strategies for breast cancer therapy" docx

Ngày tải lên : 11/08/2014, 00:23

... Superparamagnetic particles of iron oxide with appropriate surface functionalization/encapsulation, presented as magnetic fluids or magnetoliposomes, represent an attractive platform as carriers ... zeta potential value shows that the particles are negatively charged and indicates an efficient electrostatic stabilization It is well known that the magnetic properties of nanomaterials are ... solution containing Magh-Rh2(H2cit)4 nanoparticles was obtained by adjusting the pH to • Preparation and characterization of Magnetoliposomes A small unilamellar liposome based on L -a- phosphatidylcholine...

17
276
0

Báo cáo y học: " Soluble CD40 ligand-activated human peripheral B cells as surrogated antigen presenting cells: A preliminary approach for anti-HBV immunotherapy" ppsx

Ngày tải lên : 11/08/2014, 21:21

... this article as: Wu et al.: Soluble CD40 ligand-activated human peripheral B cells as surrogated antigen presenting cells: A preliminary approach for anti- HBV immunotherapy Virology Journal 2010 ... CM, Vance BA, Grupp SA, Vonderheide RH: RNA-transfected CD40-activated B cells induce functional T-cell responses against viral and tumor antigen targets: implications for pediatric immunotherapy ... of activated B lymphocytes as a novel modality Cancer Biol Ther 2003, 2:466-470 10 Kondo E, Topp MS, Kiem HP, Obata Y, Morishima Y, Kuzushima K, Tanimoto M, Harada M, Takahashi T, Akatsuka Y:...

7
235
0