a potential security problem

... and R x e To obtain our result we use variational approach even if the linearization of the periodic problem 1.1 is a non-self-adjoint operator Preliminaries Notation We will use the classical ... A C Lazer, “On Schauder’s fixed point theorem and forced second-order nonlinear oscillations,” Journal of Mathematical Analysis and Applications, vol 21, pp 421–425, 1968 8 Boundary Value Problems ... with Applications to Differential Equations, CBMS Regional Conference Series in Mathematics, no 65, American Mathematical Society, Providence, RI, USA, 1986 10 P H Rabinowitz, “Some minimax theorems...

Ngày tải lên: 21/06/2014, 11:20

... Milano, Piazza Leonardo Da Vinci 32, Italy; Accademia Nazionale delle Scienze detta dei XL, Via L Spallanzani 7, Italy Email address: marbir@mate.polimi.it Silvana Marchi: Dipartimento di Matematica, ... Riemannian p-homogeneous forms; we define a suitable notion of Kato class of measures We assume that the potential is a measure in the Kato class and we prove a Harnack inequality (on balls that are ... della Accademia Nazionale delle Scienze detta dei XL Memorie di Matematica e Applicazioni [12] M Biroli and P G Vernole, “Strongly local nonlinear Dirichlet functionals and forms,” Advances in Mathematical...

Ngày tải lên: 22/06/2014, 22:20

... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of...

Ngày tải lên: 03/11/2012, 10:52

... username database on the router, the command would be: aaa authentication login default local To log in using PPP and specify the local username database, the command would be: aaa authentication ... example, RADIUS-style accounting is used to track all usages of EXEC commands and network services, such as PPP, SLIP and ARAP aaa accounting exe start-stop radius aaa accounting network start-stop ... These attributes are compared the information contained in a database for a given user The result is returned to AAA to determine the user’s actual capabilities and restrictions This database can...

Ngày tải lên: 05/11/2013, 12:15

... which adaptive algorithm to use is application-dependent and each one comes with its associated advantages and disadvantages The LMS-type algorithms are lowcomplexity solutions that have relatively ... Equalization Problem 31.4 Regularization 31.5 Discrete-Time Adaptive Filtering Adaptive Algorithm Recapitulation • Regularization Properties of Adaptive Algorithms John F Doherty Pennsylvania ... is illustrated in Fig 31.2 31.6 Numerical Results A numerical example of the regularization characteristics of the adaptive equalization algorithms discussed is now presented A data matrix X X...

Ngày tải lên: 25/12/2013, 06:16

... Atta-Mensah Monetary and Financial Analysis Department Bank of Canada Ottawa, Ontario, Canada K 1A 0G9 jattamensah@bankofcanada.ca The views expressed in this paper are those of the author No responsibility ... Ottawa, Ontario K 1A 0G9 E-mail: publications@bankofcanada.ca Web site: http://www.bankofcanada.ca Diffusion des publications, Banque du Canada 234, rue Wellington, Ottawa (Ontario) K 1A 0G9 Adresse ... Bank of Canada Working Papers Documents de travail de la Banque du Canada Working papers are generally published in the language of the author, with an abstract in both official languages Les...

Ngày tải lên: 16/02/2014, 02:20

... from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered ... bold and underlined The F13 3A mutation was created using the following primers: F133Afw (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F13 3A- rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) ... the lack of GTP activation [8] A comparison of UMPKs from U parvum, E coli and S solfataricus, chosen to represent mycoplasma, bacteria and archaea, showed that they all shared the same fold As...

Ngày tải lên: 18/02/2014, 16:20

... of anti-placental alkaline phosphatase-agarose (anti-PLAP; Sigma) was packed into an FPLC column (Amersham Biosciences, Chalfont St Giles, UK) Purification of FN3d–AP was carried out using an AKTA ... cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system...

Ngày tải lên: 19/02/2014, 05:20

... #2006T13) and OntoNotes (Hovy et al., 2006) Clearly, as one moves towards a more application- and domaindriven idea of ‘correct’ tokenization, a more transparent, flexible, and adaptable approach to ... other abbreviations, oddly), an extra period is hallucinated, so the abbreviation also has one In contrast, C&J add a period to all final abbreviations, CoreNLP groups the final period with a final abbreviation ... track of character start and end positions as offsets between a string before and after each rule application (i.e all pairs I, O ), and these offsets are eventually traced back to the original...

Ngày tải lên: 19/02/2014, 19:20

... estimate of the remaining cost for completing the translation The variant which is mostly used is a form of beam-search, where several partial candidates are maintained in parallel, and candidates ... propose an alternative This alternative is based on the observation that phrase-based decoding can be very naturally cast as a Traveling Salesman Problem (TSP), one of the best studied problems ... path and stack algorithms David L Applegate, Robert E Bixby, Vasek Chvatal, and William J Cook 2007 The Traveling Salesman Problem: A Computational Study (Princeton Series in Applied Mathematics)...

Ngày tải lên: 20/02/2014, 07:20

... Tarauaca, Xapuri Rondonia – Ariquemes, Calama, Costa Marques, Jiparana, Ouro Preto, Pimenta Bueno, Jaru Mato Grosso: Aracotuba, Cartriquaca, Itauba, Vila Bella Provenance-wise conservation- India Introduced ... months in a year - average annual rain fall of 7.5mm per day - average of 90 rainy days/ year 18 First year post- drought data on range and mean of growth characters in the hot-spot region Characters ... Narrow MT 1710 Narrow AC 462 Narrow MT 3714 Narrow AC 441 Narrow MT 81 Broad MT 200 Broad RO 217 Narrow RO 1520 Broad Leaf surface Flat Curved Flat Curved Flat Flat Flat Flat Flat Wax coat Nil Nil...

Ngày tải lên: 21/02/2014, 04:20

... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen, ... Methods Animals All animal work was approved by the Institutional Animal Care and Use Committee (IACUC) of Integrated Laboratory Systems (ILS, Research Triangle Park, North Carolina, USA) or by ... 5.0 d, GraphPad Software, San Diego California USA [6] If data failed Bartlett’s test for equal variances, significance was evaluated using the Kruskal-Wallis test and Dunn’s multiple comparison...

Ngày tải lên: 05/03/2014, 17:20

... DAPA AT), and the residual enzymatic activity was measured using the coupled assay, as described above Plotting the residual activity against the molar ratio of inactivator over that of DAPA AT ... biotin antimetabolites actithiazic acid and alphamethyldethiobiotin Antimicrob Agents Chemother 21, 510 Okami Y, Kitahara T, Hamada M, Naganawa H & Kondo S (1974) Studies on a new amino acid antibiotic, ... c-aminobutyric acid transaminase by gabaculine and more recently by others for the inactivation of c-aminobutyric acid transaminase [32], d-amino acid aminotransferase [33], and alanine racemase [34]...

Ngày tải lên: 07/03/2014, 11:20

... producing an antidote to malaria within bacteria It is also conceivable that bacteria could be constructed to indicate the presence of certain substances such as explosives or radioactive material, ... internet databases While the procurement of such agents from nature is still the easier and cheaper method today, that may change In addition, certain pathogens such as Ebola or Marburg are difficult ... substances in bacteria – as final products of their metabolism – or for breaking down environmental pollutants through a specially constructed bacterial metabolism Researchers have already succeeded...

Ngày tải lên: 13/03/2014, 21:56

... Backdoor.Antilam.14.c, Backdoor.Antilam.20 .a, Backdoor .A Backdoor.Antilam.20.k, Backdoor.Antilam.20.m, Backdoor.Antilam.g1, BackDoor-AED trojan, PW rojan, Barrio, Barrio Trojan, Trojan.PSW.Barrio.305, ... Trojan.PSW.AlLight.10.b), Trojan.PSW.AlLight.11.d, Trojan.PSW.AlLig Trojan.PSW.AlLight.21, AntiLamer Backdoor, Backdoor.Antilam.11, Backdoor.Antilam.12 .a, Back Antilam.12.b, Backdoor.Antilam.14 .a, Backdoor.Antilam.14.c, ... DigitA1 hAnd, Lamers Death, Backdoor.Dea Death.22, Backdoor.Death.23, Backdoor.Death.24, Backdoor.Death.25 .a, Backdoor.Death.25.b Backdoor.Death.25.e, Backdoor.Death.25.f, Backdoor.Death.25.g, Backdoor.Death.25.i,...

Ngày tải lên: 14/03/2014, 20:20

... number of fatalities is an appropriate measure Table 2.2 shows the number of records,2 the average fatalities, and the uncertainty on that average3 for all terrorist attacks and attacks at shopping ... life of a few items (e.g., escape hoods) is less than 10 years, and, in such cases, an appropriately smaller value was used Labor costs are estimated based on an average security staff salary of ... relevant variables such as target type, weapon type, and geographic location Extrapolation from historical trends is also difficult because terrorist organizations are known to evolve and adapt as security...

Ngày tải lên: 15/03/2014, 15:20

... with a minimum target velocity of 0.1 miles per hour (0.147 feet/second) Have a nuisance alarm rate (NAR) and false alarm rate (FAR) not to exceed one per MDARS-E platform per shift Have an image-assessment ... a variety of applications High-power military and commercial radar sensors are typically combined with sophisticated signal processing, making them capable of excellent range accuracy and target ... electronics are based around an Analog Devices ADSP21060 SHARC processor, high-speed analog-to-digital converters to sample the radar signals, and a complex programmable logic device (CPLD) that controls...

Ngày tải lên: 22/03/2014, 11:20

... caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA ... Euglenophyceae Euglena gracilis Chloroplast DNA Chlorophyceae (green algae) Chlamydomonas reinhardtii Nuclear DNA Chloroplast DNA Higher plant Oryza sativa Nuclear DNA Chloroplast DNA PsbQ family PsbV ... PsbV and PsbU from a red alga, C caldarium, and PsbU from a cyanobacterium, T vulcanus and PsbQ from a green alga, C reinhardtii, were cloned and sequenced by means of PCR and a rapid amplification...

Ngày tải lên: 23/03/2014, 15:21

... nonlinear dynamic analysis, SAP2000 is the answer to all structural analysis and design needs SAP2000 FEATURES SAP2000 is available in three different levels: Basic (B), Plus (P) and Advanced (A) A ... Eigen and Ritz Analyses, Cable Analysis, Tension or Compression Only Analysis, Buckling Analysis, Blast Analysis, Fast Nonlinear Analysis for Dampers, Base Isolators and Support Plasticity, Energy ... Shrinkage, Relaxation, and Anchorage Slip • Pushover Analysis using Fiber Models • Bridge Base Isolation and Dampers • Explicitly Model Contact Across Gaps • Nonlinear Large Displacement Cable Analysis...

Ngày tải lên: 24/03/2014, 06:20

... instance, a given hospital is an organization A concrete security component, such as a rewall, may be also viewed as an organization since it manages a set of security rules In the organization, ... of the main drawbacks of many rewall conguration languages There are some tools that help administrators to build their security policy and to translate it to the actual conguration language (for ... use a similar approach for actions and objects An action is permitted based on the role this action plays in the organization In Or-BAC, an action role is called an activity For instance, a given...

Ngày tải lên: 28/03/2014, 22:20