a potential means for less developed countries to raise foreign capital

... Monetary and Financial Analysis Department Bank of Canada Ottawa, Ontario, Canada K 1A 0G9 jattamensah@bankofcanada.ca The views expressed in this paper are those of the author No responsibility for ... in Canada on recycled paper Bank of Canada Working Paper 2004-20 June 2004 Commodity-Linked Bonds: A Potential Means for Less- Developed Countries to Raise Foreign Capital by Joseph Atta-Mensah ... Ottawa, Ontario K 1A 0G9 E-mail: publications@bankofcanada.ca Web site: http://www.bankofcanada.ca Diffusion des publications, Banque du Canada 234, rue Wellington, Ottawa (Ontario) K 1A 0G9 Adresse...

Ngày tải lên: 16/02/2014, 02:20

... individual's health An example of such a test was the assay for homocystene that was done as part of the NHANES III The laboratory results for homocystene (that has been under study as a risk factor ... The globalization of standards creates a challenge for those standards and for feedback onto standards as practiced in the resource rich settings Scientific advances and technological innovations ... risk/benefit ratio of the survey Safety standards for specimen collectors typically follow clinical standards, and universal precautions for laboratory work have been adopted for field use Informed...

Ngày tải lên: 11/08/2014, 18:20

... Spontaneous infratentorial subdural hematoma A 41-year-old Asian woman presented to the emergency department with acute severe headache starting after a 2- day history of diarrhea Cranial computed ... computed tomography revealed an acute left-sided infratentorial subdural hematoma A cerebral angiogram did not show any abnormalities The patient denied recent trauma, intake of coagulation active ... Mongolian capital of Ulaanbaatar and receives critically ill adult patients with surgical, medical and neurological pathologies From July until 13 November 2007, a total of 203 patients were treated...

Ngày tải lên: 11/08/2014, 19:21

... to each well for h at 37°C to allow MTT to form formazan crystals by reacting with metabolically active cells Subsequently the formazan crystals were solubilized by 150 µl of DMSO The absorbance ... may lead to a failure in downstream signal cascades including PI3-K, RAS-RAF-MAPK P44/P42, and protein kinase C pathway, and subsequently block the routes to activation of more direct modulators ... following manufacturer's instructions (Gibco BRL, Canada) and dissolved in TE buffer Total RNA was quantified with a spectrophotometer (Pharmacia Biotech, Piscataway, NJ) To get rid of possible contamination...

Ngày tải lên: 14/08/2014, 19:22

... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system ... bound to charged plates and incubated with various concentrations of FN3d–AP supernatant Binding of FN3d– AP was determined by alkaline phosphatase (AP) activity measured at 405 nm The reaction rate ... mounted and analyzed as described above To semipermeabilize cells for intracellular staining, cells were incubated in 4% paraformaldehyde for 30 at °C in the first instance and then stained as described...

Ngày tải lên: 19/02/2014, 05:20

... and its derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA ... ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE *******LLL *******NNN *******SSS *******PPP chloroplasts used for this assay [15] Furthermore, the intermediate and mature forms of Toc75 in a ... to generate constructs for mutants GGA, GGE, GGL, GGN, GGD, GGS, and GGP cDNA sequences for GAA and AGA mutants were prepared using a plasmid encoding GGA as a template and primers that anneal...

Ngày tải lên: 19/02/2014, 07:20

... you’re an African American, Hispanic, American Indian/Alaska Native, Asian American, or Pacific Islander woman, you’re more than twice as likely as a Caucasian woman to get type diabetes What is ... I can to help make that happen Sure, I don’t always want to get a mammogram and no, I don’t always want to make time for physical activity And yes, there are things I sometimes am afraid to discuss ... sleep apnea after menopause Heart-Healthy Eating Eating a healthy diet is a powerful way to impact your heart health It can lower and possibly eliminate many key risk factors for heart disease,...

Ngày tải lên: 14/03/2014, 12:20

... thylakoid membranes isolated from Cheaeotoceros gracilis (A) , Pavlova gyrans (B), Laminria japonica (C) and Undaria pinnatifida (D) with antibodies raised against various extrinsic proteins Lane ... sequence data or functional requirements (see text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae ... Cyanobacteria Synechocystis sp PCC6803 Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana...

Ngày tải lên: 23/03/2014, 15:21

... and Data Analysis Preamble: The computers have become very essential tools for data analysis, Information processing, modeling and graphical presentation The advancements for PC software and declining ... economic status, health, education, nutrition, caste, religion, race, rural-urban and status of husband and wife; Nuptiality Concept and analysis of marital status, single mean age at marriage; Synthetic ... for a student who aspires for management of a firm or company or any enterprises this age is age of management So managerial economics is very important to learn the art of management for achieving...

Ngày tải lên: 31/03/2014, 03:20

... leaf (Table 3) The systemic effect also spread laterally from one leaf of the pair to the other leaf of the same pair (Table 3), and in the same leaf from the adaxial to the abaxial surface (Table ... cotton and sprayed on the abaxial (under) leaf surface with 152 DAGMAR S ROVERATTl, ANA REGINA R TEIXEIRA and WALKYRIA B C MORAES the inducer preparation, using nitrogen as the propellent gas, ... contra uma posterior lnfec^ao com o fungo Hemileia vastatrix, agente causa) da ferrugem alaranjada cafeeiro O Thuricide H D , foi efetivo em induzir prote^ao nas plantas desde a concentra^ao de...

Ngày tải lên: 05/05/2014, 08:45

... | Toronto | Washington D.C Special discounts on bulk quantities of AMACOM books are available to corporations, professional associations, and other organizations For details, contact Special ... don’t always end up as successful as Jack—what’s different about Jack?) His father’s parting message was, “Always act as a gentleman.” These words, spoken decades ago, called Jack to develop a sense ... that have yet to be expanded Our gains in this area can be great Maynard, R “How to Be a Great Boss.” Nation’s Business79 (December 1991): 44 Stan, and Grant, Michael, “Smart Leadership in Tough...

Ngày tải lên: 03/06/2014, 01:01

... mechanism to adjust dupthresh dynamically The author utilizes a combined cost function for retransmission timeouts (RTO) and false fast retransmissions to adapt the false fast retransmit avoidance ratio ... for the estimations of RTT and RTO the authors proposed an idea to correct the sampling bias against long RTT samples Compared to Blanton-Allman algorithm, RR TCP needs excessive computational ... loss and react accordingly TCP New Jersey has two key components in its scheme, timestamp based available bandwidth estimation (TABE) and congestion warning scheme To estimate the available bandwidth,...

Ngày tải lên: 21/06/2014, 02:20

... power of our statistical analysis and make our data vulnerable to a statistical type II error Therefore, our data not allow for advocating complement serum levels as a new biomarker until definitively ... the traditional activation cascade using C3 convertases or C5 convertases [13] As a result, C 5a may be generated via thrombin-mediated coagulation abnormalities that have been documented in anorexia ... concentrations between cohorts using Wilcoxon rank sum test Data are expressed as median (interquartile range) b Laboratory samples were unavailable for one patient for C 5a and CH50, nine controls for...

Ngày tải lên: 09/08/2014, 01:21

... used were as follows: β-actin forward, GAGCTACGAGCTGCCTGACG; β-actin reverse, GTAGTTTCGTGGATGCCACAGGACT; CD59 forward, ATGCGTGTCTCATTAC; and CD59 reverse TTCTCTGATAAGGATGTC The cycling parameters ... (Luton, UK) Statistical analysis All data were expressed as the mean of the individual experiments ± the standard error of the mean Data were analysed using one-way or two-way analysis of variance ... that both mevastatin and lovastatin increased CD59 expression to a similar degree to atorvastatin (data not shown), suggesting this is a statin class effect Chemical mimics of hypoxia enhance atorvastatininduced...

Ngày tải lên: 09/08/2014, 08:22

... B, Akoka S, Avimadje AM, Garaud P, Naccache L, Le Pape A, Valat JP: Magnetic resonance imaging: a valuable method for the detection of synovial inflammation in rheumatoid arthritis J Rheumatol ... Maldonado-Cocco J, Orozco-Alcala J, Prieur AM, Suarez-Almazor ME, Woo P, International League of Associations for Rheumatology: International League of Associations for Rheumatology classification ... Highton J, Markham V, Doyle TC, Davidson PL: Clinical characteristics of an anatomical hand index measured in patients with rheumatoid arthritis as a potential outcome measure Rheumatology (Oxford)...

Ngày tải lên: 09/08/2014, 10:22

... secretagogue The volume of each saliva sample was measured The saliva samples were then frozen at -80°C until analyzed Statistical analyses For this study, we have standardized both saliva and tear ... study, ANA staining, saliva collections, data analyses, and manuscript preparation All authors read and approved the final manuscript Proposed genetic predisposition for and fatty acid homeostasis/trans6.NOD-Aec1Aec2 ... genetic background strains at an earlier age, often necessitating collections of saliva and tears when the mice are as young as to weeks of age and are less than half the size of adult mice, and,...

Ngày tải lên: 09/08/2014, 13:22

... in red (b) Active Site comparison of abrin -a (red) AAG A- chain (black) AAG A- chain (black) and AAG C-chain (blue) These figures were generated by O program (Jones et al and AAG C-chain (blue) ... Bagaria A, Surendranath K, Ramagopal UA, Ramakumar S, Karande AA: Structure-Function Analysis and Insights into the Reduced Toxicity of Abrus precatorius Agglutinin I in Relation to Abrin J Biol Chem ... also thank to the National Science Council of Taiwan for financial support They are indebted to SPring-8 and the National Synchrotron Radiation Research Center for data collection Author Details...

Ngày tải lên: 10/08/2014, 05:21

... or a poor use of scarce resources, it appears that many SAP operators and other public health actors have failed to identify and adequately address the concerns of law enforcement in planning and ... public officials as a means of enrolling drug users into treatment [38] Qualitative research suggests that officers often view arrest and incarceration as fundamentally flawed approaches to reducing ... interpret a person's illegal behavior as stemming from a mental illness, officers may arrest that person if they perceive that no appropriate alternative to incarceration is available This view may...

Ngày tải lên: 11/08/2014, 18:20

... J: Normal mitochondrial DNA and respiratory chain activity in familial dysautonomia fibroblasts Biochem Mol Med 1996, 59:20-27 Shi Y: A structural view of mitochondria-mediated apoptosis Nat Struct ... Pradhan L, Ali M, Agrawal KC: HAART drugs induce oxidative stress in human endothelial cells and increase endothelial recruitment of mononuclear cells: exacerbation by inflammatory cytokines and ... and amelioration by antioxidants Cardiovasc Toxicol 2004, 4:287-302 Gomez-Vera J, de Alarcon A, Jimenez-Mejias ME, Acosta D, Prados D, Viciana P: Hyperglycemia associated with protease inhibitors...

Ngày tải lên: 12/08/2014, 04:20

... years Potential confounders of age, gender, BMI, and tibial plateau area for annual change in cartilage volume were included in multivariate analyses A P value less than 0.05 (two-tailed) was regarded ... was seen in the lateral compartment Although incidence of lateral BMLs was not associated with annual change in lateral cartilage volume, having an incident lateral BML was associated with a ... coefficients of variation for the medial and lateral tibial cartilage volume measures were 3.4% and 2.0% respectively [35,36] Annual change in cartilage volume was calculated as follow up cartilage volume...

Ngày tải lên: 12/08/2014, 11:22