a potential contributor to the development of hepatocellular carcinoma
Báo cáo y học: " Control of allergic rhinitis and asthma test – a formal approach to the development of a measuring tool" ppt
... Luciano Margarida Trindade Rita Câmara Rodrigo Alves Additional file CARAT – Control of Allergic Rhinitis and Asthma Test This is a translation to English of the of the preliminary version of ... meeting of the Formal Consensus Process Ana Arrobas Ana Todo-Bom Ângela Gaspar Aurora Carvalho Carlos Alves Carlos Lopes Fernando Calvário Authors' contributions LNS participated in data collection, ... round, facilitated the data gathering and analysis, while maintaining anonymity of the answers (for further details see Additional file 1) In the first round, each participant was asked to choose...
- 9
- 370
- 0
Tài liệu A thesis submitted to The University of Birmingham for the degree of Clinical Psychology Doctorate docx
... calculated as 82 It is unclear, but Fabiani et al (1996) and Fabiani et al (2000) appear to report the same participants Karwautz at al (2008) and Wagner et al (2008) report the same participants, ... follow a GFD (Mihailidi, Paspalaki, Katakis, & Evangeliou, 2003) The risk of cancer decreases to the same as a person without CD after a GFD has been followed for to years (Coeliac UK, 2007) In addition ... such a feature, indicates partial evidence, and indicates there was definitely evidence for such a feature in the study A further adaptation was sorting of the categories to be scored As the studies...
- 171
- 709
- 0
Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc
... decided to use the hierarchical clustering algorithm readily available in the MATLAB (MATrix LABoratory) programming language After some testing with various similarity functions and linkage types, ... in such a way that line crossings are avoided when connecting clusters As we can see, the dissimilarities among the top 30 associations to palm are all in the upper half of the scale and not ... words that are in the middle of the frequency range Figures to are based on the association lists for the words palm and poach Given that our term/context matrices are very sparse with each of their...
- 4
- 536
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... al A B C D other Statistical analysis (Student’s t-test) between the MR-1R values and the sum of the values of the omcA– and the omcB– mutants revealed that there is no statistically significant...
- 11
- 731
- 0
Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf
... Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix An appropriate algebraic method that has the capability to reduce the dimensionality of a ... clusters are much more salient Also, widely and rural are well within the adjective cluster The comparison of the two dendrograms indicates that the SVD was capable of making appropriate generalizations ... with our algorithms (SVD and clustering), we decided to restrict the number of rows to a vocabulary appropriate for evaluation purposes Since we are not aware of any standard vocabulary previously...
- 4
- 433
- 0
A further contribution to the study of the mortuary customs of the North American Indians docx
... layer of Dall] There are some crania found by us in the lowermost part of the Amaknak cave and a cranium obtained at Adakh, near the anchorage in the Bay of Islands These were deposited in a ... Indians he learned that tradition among the Aleuts assigned Kagamale, the island in question, as the last resting-place of a great chief, known as Karkhayahouchak Last year the captain was in the ... ceases, at the end of the year, they have high mass said for the benefit of the soul of the departed; after this they again appear upon the arena of their wild sports and continue to be gay and happy...
- 108
- 604
- 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... i,e, the morphemes are in the right order and the relevant phonological rules have applied correctly over the appropriate domains n we then pass the morphological analysis off to the syntactic parser ... well-formed Also exemplary of the division of duty between the morphophonological parser and the syntactic parser is the dual status of subcategorization in Warlpiri For example, the ergative case suffix...
- 8
- 522
- 0
The road to reality a complete guide to the laws of the universe penrose, roger
... control the behaviour of the world and whatever their relations might be to mathematical truth This realization that the key to the understanding of Nature lay within an unassailable mathematics was ... in the time of Pythagoras What about the geometrical theorems that the Pythagoreans had obtained using their procedures of mathematical proof? They too have a clear validity today, but now there ... heavens As he stood there, a dark cloud became apparent at the head of the beam, giving the whole structure the appearance of a distant giant parasol, glowing evilly, with a smoky Xaming staV The...
- 1,123
- 542
- 4
Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt
... computational study in the literature that can be applied to the automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and generator called HAHAcronym ... name The three “palatable” neologisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing ... amusing and have a nice ring to them As a matter of fact, it turns out that the name Eatalian is actually used by at least one real Italian restaurant located in Los Angeles, CA3 For the same set of...
- 9
- 518
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... optimizing the availability of Ca2+ and Cl– cofactors for water oxidation in the green lineage In fact, all of the thylakoid membranes from diatoms (C gracilis and P tricornutum), a haptophyte (P gyrans) ... Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride ... shown) The behavior of this band in the diatom is thus similar to that of the PsbPlike protein in cyanobacteria [3,12] The fact that C gracilis, P gyrans, L japonica and U pinnatifida contained bands...
- 11
- 501
- 0
A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy potx
... Cornell and the secretaries that take care of the paperwork and negotiate the grand bureaucracies of the academic world, Douglas Milton, Judy Wilson, Deb Hatfield, Kacey Bray, Larissa Vygran, and ... above the oxide For the case of the GaAs/AlGaAs heterojunction, researchers at Bell Labs had the clever idea of introducing impurity atoms far enough away from the interface such that they can ... electrically contacted suspended beam and a nearby gate electrode A voltage Vg, applied to this capacitor induces a charge q = CgVg onto the beam where Cg is the capacitance of the beam to the gate electrode...
- 140
- 510
- 0
Cinema 4D Training Introducing VRay: A short guide to the settings of VRayForC4D pptx
... is to use a VRayFastSSS2 material The parameters of which are available as an extension of the standard VRay Advanced material and as a standalone material called the VRayFastSSS2 material The ... use the SSS layer in the VRay Advanced material to make a semi accurate portrayal of a marble floor ‘VrayAdvancedMaterial’ and ‘VRayFastSSS2 Material’ SSS calculated as part of the refraction layer ... optimal results Create a standard VRayAdvanced material and apply it to the cube Create a VRayDisplaceMaterial and also apply to the cube object (after the first material) For more in depth features...
- 35
- 1,091
- 4
a concise introduction to the theory of numbers- baker a.
... to as a divisor of a, and a is called a multiple of b The relation bJa is reflexive and transitive but not symmetric; in fact if bla and alb then a = b Clearly also if b (a then b s a and SO a ... for all rationals p/q (q > 0) For the proof, we shall assume, as clearly we may, that a is real, and we shall apply the mean-value theorem to P, the minimal polynomial for a We have, for any rational ... point, and similarly that the tangent at a rational point intersects again at a rational point Thus, Fermat remarked, if there is a rational point on the curve other than the point at infinity, then,...
- 54
- 527
- 0
Game Day: A Rollicking Journey to the Heart of College Football pptx
... Eric to this day and am glad to call him a friend I was so proud of him the day he was inducted into the Hall of Fame That tall, skinny kid at the car wash in Sealy went on to become one of the all-time ... college and the NFL, so they’re able to learn a ton more from some excellent coaches—and that only makes them better Great examples are Pete Carroll of USC and Nick Saban at Alabama— they’ve been around ... school team, was the best football team I ever played on To this day, my teammates and I stay in touch and are really close I was named Player of the Year in 1978 for the state of Texas after rushing...
- 255
- 305
- 0
a dissertation submitted to the faculty of the graduate school
... orientation of the target can be obtained from the compass device that estimates and analyzes angles of arrival of acoustic signals emitted from beacons on the ceiling The system achieves an accuracy ... making it advance substantially towards a practical system Event-driven localization makes use of events (e.g ultrasound or air blast propagation, optical or laser beam scan), that are generated ... spacial signatures of the target in the map of monitored area Instead of estimating each position point separately in a movement trace, we convert the original tracking problem to the problem of...
- 188
- 887
- 0
jesus our priest a christian approach to the priesthood of christ apr 2010
... not only the Messiah and the Son of God but also the Son of Man who will be seated at the right hand of God and will come ‘with the clouds of heaven’ at the climax of history to gather in the elect ... bread, blessed and broke it, and gave it to them, and said: “Take, this is my body.” And he took a cup, and when he had given thanks he gave it to them, and they all drank of it And he said to them, ... now at the small print Biblical scholars widely agree that the ‘bread saying’ derives from the historical Jesus Many argue as well that the ‘cup saying’ is also traceable to the historical Jesus...
- 322
- 436
- 0
accessing kant a relaxed introduction to the critique of pure reason nov 2005
... Diachronic Manifolds: The Analogies of Experience Philosophical analogies The Auditory Model Change in the Auditory Model Substance in the Auditory Model Causality in the Auditory Model Space in the Auditory ... I call them ‘Apollonian’ and ‘Dionysian’ The Apollonian approach is marked by an especially close reading of the text, philological attention to nuances of interpretation, a careful tracing of ... freedom, and immortality are the classical themes of speculative metaphysics, but unlike the concepts of a metaphysics of nature—paradigmatically space, time, substance, and causation—which, Kant was...
- 325
- 233
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25