... the Mississippi; the place where Lafayette was received by a grateful people; the place where the Santa Fe, the Oregon, and other trails originated; the place where Lewis and Clark prepared for ... Because downtown areas usually have the primary concentration of historic buildings in a given area, Main Street has the potential to dramatically affect the preservation, renovation and restoration ... delegated by France as its representative, and at which, on the morning of March 10, 1804, Captain Stoddard, as the agent of the United States, took formal possession of the Louisiana Purchase and
Ngày tải lên: 20/10/2022, 19:42
... the Mississippi; the place where Lafayette was received by a grateful people; the place where the Santa Fe, the Oregon, and other trails originated; the place where Lewis and Clark prepared for ... a given area, Main Street has the potential to dramatically affect the preservation, renovation and restoration of a town's aesthetic history Main Street may affect the aesthetic landscape of ... to the Arthurdale New Deal Homestead 42 Trace Fork Canyon in Kanawha County is on the list, also, endangered by a twenty-eight acre shopping mall?43 The canyon contains Native American artifacts,
Ngày tải lên: 20/10/2022, 19:43
A study of the linguistic features of saying verbs used in political documents in english and vietnamese
... another beneficial for the language learners For the have some implications for teaching, learning and translating language teaching, this study may be another sign to imply the need 5.2 IMPLICATIONS ... guest at a formal social occasion, or give information 4.2 SYNTACTIC FEATURES OF SAYING VERBS about transport in a station or airport via a public address system, for 4.2.1 Syntactic Features ... be many Vietnamese linguists, especially by Cao Xuan Hao and Hoang Van Van Cao Xuan Hao [31] offerred an overview of functional approaches and solved the issues of applying Functional Grammar
Ngày tải lên: 26/11/2013, 13:19
Ethics and Professionalism: A Guide for the Physician Assistant ppt
... training is a fast track to medical practice It is also a fast track to the development of professionalism and ethically appropriate medical behavior There are advantages and disadvantages ... presented a list of standards for professionalism that the authors think should be universally accepted.10 (Box 1-3) In May 2000, the American Academy of Physician Assistants (AAPA) adopted ... clinical practice The most obvious advantage to the fast-track PA training is also its short duration The average PA program is 26 months The didactic year is usually only 12 months The
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf
... evaluate automatic summarisation systems and, at the same time, similarity metrics conceived as well to evaluate summarisation systems. There- fore, testing the validity of the QARLA proposal implies ... human assessments has some clear ad- vantages: the results of the evaluation are inter- pretable, and we can trace what a system is do- ing well, and what is doing poorly. But it also has a couple ... between au- tomatic summaries (the x (a, a ) factor in the in- equality). Finally, adding elements to A can only increase the chances of finding a pair of automatic summaries satisfying the condition
Ngày tải lên: 17/03/2014, 05:20
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
... GTPcS-loaded Rac2, MgSO 4 and an optimal amount of arachidonic acid determined for each assay of oxidase activation [12]. The rate of O 2 – production by the activated NADPH oxidase was calculated ... contaminant [15]. The identity of S10 0A8 was further ascertained by amino-acid sequencing, using Edman degra- dation. As S10 0A9 has a blocked N-terminal amino acid, analysis of the protein was carried ... p47phox and Rac was maintained at a value of 4, i.e. a nonsaturating concentration with respect to p47phox and Rac2 (cf. Fig. 3A) . The concentration of flavocytochrome b was maintained at a fixed value,
Ngày tải lên: 18/03/2014, 01:20
University Partnerships: A Bibliography for the Trans-Institutional Alliance for for Global Health Project pdf
... leishmaniasis, and African trypanosomiasis. Although profit-minded pharmaceutical companies have long shied away from research and development on drugs against maladies that mainly afflict the ... presented at the annual meeting of the International Studies Association, Hilton Hawaiian Village, Honolulu, Hawaii, Mar 05, 2005. This paper argues for a reformulation of global health pedagogy in ... organization (NGO) country collaboration for greater impact? Alliances such as the CORE Group and the White Ribbon Alliance for Safe Motherhood (WRA) help donors and partners meet these challenges
Ngày tải lên: 22/03/2014, 15:21
Civil liability resulting from transfrontier environmental damage: a case for the Hague Conference? pot
... 14 In the 1970’s, with the accession of Australia and Japan, then the United States and Canada, the organisation changed its name and was transformed into the Nuclear Energy Agency. 15 The Convention ... non-Contractual Obligations (1), The Japanese Annual of International Law No 39 (1996), and Draft Articles on the Law Applicable to Contractual and non-Contractual Obligations (2), Japanese Annual ... the injured party (Gunstigkeitsprinzip) 32 2. The law of the place of the damage (lex damni) 34 3. The law of the place of the dangerous activity (lex loci actus) 36 4. The law of the place
Ngày tải lên: 23/03/2014, 00:20
Future R&D Environments A Report for the National Institute of Standards and Technology potx
... to the furtherance of science and technology and to their use for the general welfare Upon the authority of the charter granted to it by the Congress in 1863, the Academy has a mandate that requires ... licensing-out as a business practice These market forces are redefining what value means to a company The basis of market capitalization is changing from a focus on tangible to intangible assets Companies ... partnerships and alliances appear to be motivated by a variety of corporate concerns and circumstances The NSB broadly characterizes R&D partnerships as collaborations that allow “individual partners
Ngày tải lên: 23/03/2014, 01:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC
Ngày tải lên: 23/03/2014, 13:20
A Handbook for the Mechanical Designer ppt
... when selecting a fan near the limits of tabular data . The perfor- mance curve also is a valuable tool when evaluating fan perfor- mance in the field. Fan performance tables and curves are based on standard ... Contents 1 Fan Types Axial Fan - An axial fan discharges air parallel to the axis of the impeller rotation. As a general rule, axial fans are preferred for high volume, low pressure, and non-ducted ... Axial Fan Types Propeller, Tube Axial and Vane Axial. Centrifugal Fan - Centrifugal fans discharge air perpendicular to the axis of the impeller rotation. As a general rule, centrifugal fans
Ngày tải lên: 01/04/2014, 00:20
a creed for the third millennium
... and Daphne back into their chairs and I took the floor! I told them they were all behaving like kids and I was ashamed to call myself a Pat-Pat. That's about when it all came out that all ... Mama at the foot of the elliptical lacquer table and therefore closest to the kitchen door, Joshua at the head of the table gazing at her, Mary and James and Miriam down one side, and Andrew and ... six candidates was perhaps surprising, but Drs Abraham... Holloman and Hartford and Washington to satisfy the bureaucratic appetite for paper, paper, ever more paper; the day all the
Ngày tải lên: 30/05/2014, 22:51
a place for consciousness probing the deep structure of the natural world nov 2004
... present a fair overview of them The argument against physicalism is an argument against the claim that the physical facts entail the facts about phenomenal consciousness The form of the argument ... and directions from here; and it allows us to partition the world into physical information that is available at that place (because signals from other places may have traveled to it) and information ... on whether we perceive it as facing upward or downward the kinds of facts that ordinary physical facts can form a basis for? And, if so, in what way can physical facts provide a basis for them?...
Ngày tải lên: 11/06/2014, 10:40
a study on the main features of short jokes and implications for teaching speaking to students of grade 12 at ngoc tao upper secondary school
... said and then they followed what the teacher said The students worked together in pair work They had to make a dialogue in front of the class then translated what they had spoken Observation: the ... meanings For example, if someone says The peasants are revolting”, this is a pun because it can be interpreted as meaning either that the peasants are fighting against authority, or that they ... fun at themselves That is as much recognition as it is about their ability to laugh at themselves Most words in English have several meanings This can be an advantage for learners as they can...
Ngày tải lên: 25/12/2015, 17:19
Tài liệu COMPUTER NUMERICAL CONTROL PROGRAMMING BASICS A Primer for the SkillsUSA/VICA Championships Steve docx
... storage matrix The advantage of the CDC feature is that it: allows the use of cutters that have been sharpened to a smaller diameter permits the use of a larger or smaller tool already in the machine’s ... without actually cutting a part on the machine This allows the student to check the program for accuracy and make corrections which avoids machine crashes, damage, and scrap parts 31 CNC Programming ... information Each block should contain enough information to perform one machining operation Word Address Format Every program for any part to be machined, must be put in a 17 format that the machine...
Ngày tải lên: 25/12/2013, 05:16
Tài liệu MARKETING PLACES- CONCEPTS ABOUT A PLACE UNDER THE PERSPECTIVE OF MARKETING PLACES pdf
... (structure) analysis Establish a position in the industry Create an advantage Act early to take advantage of structural changes Sustain the advantage Global competition Competitive advantage of companies ... about a place political crisis… - Economic, financial, and under the perspective of Marketing Places c/ Characteristics of a place A place in terms of administrative geography may have several ... Concepts about a place under the perspective of Marketing Places a/ What a place means? − A place is a modern country, a geographical & political space in physical terms − A region with cultural,...
Ngày tải lên: 16/01/2014, 11:37
Tài liệu Practical mod_perl-CHAPTER 8:Choosing a Platform for the Best Performance docx
... Redundant Array of Inexpensive Disks (RAID) An array of physical disks, usually treated by the operating system as one single disk, and often forced to appear that way by the hardware The reason for ... you add more of them) This means that you should choose hardware and OSes that can talk to other machines and become part of a cluster On the other hand, if you prepare for a lot of traffic and ... need a very fast disk, especially when using a relational database Don’t spend the money on a fancy video card and monitor! A cheap card and a 14-inch monochrome monitor are perfectly adequate for...
Ngày tải lên: 26/01/2014, 07:20
Tài liệu Corporate Governance Best Practices - A Blueprint for the Post-Enron Era docx
... accounting advisors in the application of the Sarbanes-Oxley Act and any final and proposed rules of the major U.S stock exchanges and the SEC Is the board managed as effectively as the company is managed? ... includes a means to evaluate the performance of the board as a whole, the performance of each committee, and the performance of each individual director Accountability is an important element of board ... develop and disclose their mechanisms and processes to annually evaluate, the performance of the board as a whole, the performance of each board committee, and the performance of each individual director...
Ngày tải lên: 26/01/2014, 16:20
Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt
... of a patient's asthma control with a quick glance Patients assume active role in their health care Implementation: The Asthma Task Force developed an Asthma Test, Asthma Management Plan, and Asthma ... include attempts to maintain physical and emotional balance and harmony, religious practices, and ethnobotanical and other therapies These therapies include prayer, Vick’s VapoRub, siete jarabes, aloe ... within the health centers The Asthma Task Force developed medical record documents to facilitate superior asthma care (including an Asthma Test, Asthma Management Plan, and Asthma Action Plan),...
Ngày tải lên: 14/02/2014, 13:20
Tài liệu A Place in the Sun pptx
... sensed that he was a boy rather than a man and had the odd feeling that, faced with a real crisis, he would confirm this tragically It was night aboard the Glory of the Galaxy Which was to say the ... that he is expendable His life for the furtherance of the new Galactic Federation." "But—" "And the President is aboard that ship Maybe he can't as much for the Galaxy in the long run as Mayhem ... importance could not be measured by mere human standards in those early days when the Galactic League was becoming the Galactic Federation The name of the man with whom they maintained contact was...
Ngày tải lên: 17/02/2014, 09:20